ID: 1012500329

View in Genome Browser
Species Human (GRCh38)
Location 6:99881213-99881235
Sequence CGGTGTATATGGAGGAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012500326_1012500329 -9 Left 1012500326 6:99881199-99881221 CCAGAAGGAGAGAGCGGTGTATA No data
Right 1012500329 6:99881213-99881235 CGGTGTATATGGAGGAAAAATGG No data
1012500325_1012500329 -8 Left 1012500325 6:99881198-99881220 CCCAGAAGGAGAGAGCGGTGTAT No data
Right 1012500329 6:99881213-99881235 CGGTGTATATGGAGGAAAAATGG No data
1012500318_1012500329 26 Left 1012500318 6:99881164-99881186 CCTGAAGGATCAGGGCTGGGAGG No data
Right 1012500329 6:99881213-99881235 CGGTGTATATGGAGGAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012500329 Original CRISPR CGGTGTATATGGAGGAAAAA TGG Intergenic
No off target data available for this crispr