ID: 1012509757

View in Genome Browser
Species Human (GRCh38)
Location 6:99989772-99989794
Sequence TTATATTTTCAAAAAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 775
Summary {0: 1, 1: 0, 2: 5, 3: 65, 4: 704}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012509757 Original CRISPR TTATATTTTCAAAAAGTGGA AGG (reversed) Intronic
900919098 1:5659482-5659504 GTATACTTACAAAAAGGGGAAGG - Intergenic
901073627 1:6537776-6537798 TAATATTTTCATATAGTGTAAGG - Intronic
902446698 1:16470824-16470846 TAATATTTGCAAATAGTGGCCGG + Intergenic
902523089 1:17033191-17033213 TTATATTATGATAAAGTGTAGGG - Intronic
902702003 1:18178870-18178892 TTAGATTCTCAAAGAGAGGAAGG - Intronic
905065506 1:35177772-35177794 TAGAATTTTTAAAAAGTGGATGG - Intronic
905492076 1:38352503-38352525 TTATATATTCAAAATATGCAAGG + Intergenic
905602435 1:39265136-39265158 TGAAATTTTCAAAAAATGGGAGG + Intronic
905949337 1:41934759-41934781 CCAATTTTTCAAAAAGTGGAGGG + Intronic
906386371 1:45372240-45372262 TTATTTTTTCAAAAATAAGATGG - Intronic
906903873 1:49867013-49867035 TGATATTTTCAAAATCTAGAAGG - Intronic
908735608 1:67273196-67273218 TTATTTTTTCAGAGAATGGATGG + Intergenic
909255229 1:73411963-73411985 TTCTATTTTAAAATAGTGCAAGG - Intergenic
909469868 1:76014810-76014832 GTATAATTTCAAAGAGAGGAAGG + Intergenic
909491724 1:76233839-76233861 TTATATATACAAAAAGTATATGG - Intronic
909495820 1:76277447-76277469 TTCTATATTCAAAAAATAGATGG + Intronic
909613474 1:77578624-77578646 TTATATTGTGCAAAAGTGGAGGG - Intronic
909754851 1:79212394-79212416 TTATATTTTAACAAAGTGGATGG + Intergenic
910524018 1:88156695-88156717 TTATATGTTCCAACATTGGAGGG + Intergenic
910970559 1:92851665-92851687 ATATTTTTTCAGAGAGTGGATGG - Intronic
911212521 1:95157553-95157575 TTATATTTTTAAAAAATGAAAGG + Intronic
911214955 1:95182831-95182853 TTTTTTTTTTAAGAAGTGGATGG + Intronic
911273203 1:95828691-95828713 TTATATTTTCAAAAAGAATTTGG + Intergenic
911643212 1:100311162-100311184 GAATATTTTCTAAAAATGGAGGG + Intergenic
911735788 1:101335240-101335262 TCATATTTTCAACATGTGGCAGG - Intergenic
911858371 1:102912268-102912290 ATAAATTTTCAAAATCTGGATGG + Intronic
911964397 1:104348315-104348337 TCATATTTTCAAGAAGAGAAGGG + Intergenic
912186390 1:107281427-107281449 TTATATTTTGCAAAACTTGATGG + Intronic
912454802 1:109790171-109790193 TCATGTACTCAAAAAGTGGAGGG - Intergenic
913451019 1:118992732-118992754 TTTTATTTTTAAAAAGTGTGAGG - Intergenic
914226638 1:145725063-145725085 TTAAATTTTTAAAAATTGAAAGG - Intronic
914421529 1:147532610-147532632 TTACATTTTTAAATAGTGGTTGG - Intergenic
915157005 1:153885423-153885445 TTAAATTTTAAAAAAGGGGCTGG + Intronic
915956857 1:160227847-160227869 TCATATGTTCAGAAAGTGGTAGG - Intronic
916728559 1:167545629-167545651 TTGTATTTTCATAAAGAGGGTGG - Intronic
916777051 1:167977757-167977779 TAAAATTTTTAAATAGTGGATGG - Intronic
917229328 1:172819093-172819115 TAATAGTCTCAAAAAGTGCATGG - Intergenic
917514707 1:175697860-175697882 TTATATCTGCAAAATGAGGATGG - Intronic
917800817 1:178568468-178568490 TTCTAATTTCTTAAAGTGGAAGG + Intergenic
918284506 1:183038747-183038769 TTTTATTATCAAAAACTGTAAGG + Intronic
918875188 1:190032264-190032286 TCATATTTTTAAAAATTGGCTGG + Intergenic
918959178 1:191249507-191249529 ATATATTTTCAACATGTGGTTGG - Intergenic
919360379 1:196585307-196585329 TTATCTCTTCAAAGAGAGGATGG + Intronic
919973347 1:202594874-202594896 TTTTATTTTAAAAAGGGGGAAGG - Exonic
920320273 1:205116391-205116413 TTATACTTTTAAGAAGTAGAGGG - Intronic
920599427 1:207308087-207308109 TAATAGTTTCCAAAATTGGAAGG + Intergenic
920729781 1:208472565-208472587 TTATAGTGAAAAAAAGTGGATGG + Intergenic
920944203 1:210512769-210512791 TCATATATTGGAAAAGTGGAAGG + Intronic
921171068 1:212550126-212550148 ATACAGTTTCAAAAACTGGATGG - Intergenic
921493980 1:215813561-215813583 TTATATTTTAACAAAGCAGAAGG + Intronic
921585687 1:216943649-216943671 ATATACTCTCAAAAAGTGAATGG + Intronic
921604736 1:217139594-217139616 TTATATTTTCAAAAAGTTCAGGG - Intergenic
921629846 1:217420085-217420107 TAAAATTTTTAAAAAGTGGTGGG - Intergenic
921940672 1:220835581-220835603 ATATATTTTAAAGAAATGGAAGG - Intergenic
922819485 1:228474204-228474226 TTCTATTTTTAAAAAGTGAGAGG - Intergenic
922973854 1:229767110-229767132 TTATAATTTCAAAAAACTGAAGG + Intergenic
923239333 1:232065936-232065958 TACGATTTTCATAAAGTGGAAGG + Intergenic
923858114 1:237866211-237866233 TTATAGTAGCAAAAGGTGGAGGG - Intergenic
923901929 1:238335592-238335614 TTCTGTTTTTAAAAGGTGGAGGG - Intergenic
924371251 1:243352767-243352789 GCATATGTACAAAAAGTGGAAGG - Intronic
924584315 1:245348529-245348551 TTGTGTTTTCACACAGTGGAGGG + Intronic
924700558 1:246447840-246447862 TTCTATTTGAAAAAAGTGGGAGG - Intronic
1063040523 10:2332845-2332867 TGAGATTTTTAAAAAGTGGCTGG - Intergenic
1063358966 10:5432742-5432764 TTATATATTTTAAAAGTGGAAGG - Intronic
1063799349 10:9555218-9555240 TTATATTTTGAAAAACAGGTAGG + Intergenic
1063898063 10:10702878-10702900 TTATATTTTTAAAAAGGGGTTGG - Intergenic
1064779636 10:18820789-18820811 TTATATTTTTAATAAGTTCAGGG + Intergenic
1065098715 10:22311163-22311185 TTATATCTTTAAAAAGAGGGAGG - Intergenic
1065213131 10:23423812-23423834 ATATATTTTGGGAAAGTGGAGGG - Intergenic
1065662007 10:28014288-28014310 CTATTTTTTAAAAAAATGGAAGG - Intergenic
1065812263 10:29452977-29452999 TTTTCTTTTCAAAAAGAGGAAGG + Intergenic
1066119637 10:32272679-32272701 ATATATTTTTAAAAAGTTGAGGG - Intronic
1066545324 10:36493647-36493669 TCATACATTCCAAAAGTGGAAGG - Intergenic
1067002472 10:42629951-42629973 TTATATTTTAAAAGTGGGGAGGG - Intronic
1069002594 10:63282614-63282636 TTATATTTTTAAAATGTACAGGG + Intronic
1069358544 10:67615160-67615182 TTATATTTTTAAAAAGGTTATGG - Intronic
1070258149 10:74827512-74827534 GTATTTTTTAAAAACGTGGAAGG + Intronic
1071125637 10:82331851-82331873 TTATAATTTCCAAATGTTGAAGG - Intronic
1071390096 10:85165405-85165427 AAATATTTGGAAAAAGTGGATGG + Intergenic
1071413664 10:85421296-85421318 TGACAATTTCAAAAACTGGAGGG - Intergenic
1071465064 10:85932210-85932232 TCAATTTTTAAAAAAGTGGATGG - Intronic
1073610102 10:104934738-104934760 TTATAATTCCAAAAGGAGGATGG - Intronic
1073938511 10:108664600-108664622 TGATATTTGCAGAAAATGGAAGG - Intergenic
1073948534 10:108780756-108780778 TTATTTTTTAAAAAAGTGCATGG - Intergenic
1074184339 10:111087841-111087863 ATATATTTTTAAAAAATGGAAGG - Intergenic
1074342768 10:112650462-112650484 TTTTTTTTTAAATAAGTGGAAGG + Intronic
1074418774 10:113290679-113290701 TTAGATTTTTACAAGGTGGAAGG - Intergenic
1075533623 10:123252138-123252160 TTATCTTTTTAAAAGGTGGAGGG - Intergenic
1075602812 10:123783073-123783095 TTATATGGTCTAAAAATGGAGGG + Intronic
1077873490 11:6283194-6283216 TTATCATTTCAAAAAGTGAAGGG + Intergenic
1077985661 11:7348716-7348738 TTGTATTTTCAAAGTGCGGATGG + Intronic
1078292626 11:10028213-10028235 TTAGACTTTTAGAAAGTGGATGG - Intronic
1078420834 11:11211263-11211285 TGATATTTTTAAAAATTGAAGGG - Intergenic
1078614344 11:12851495-12851517 TTATTTTTTAAAAAAATGGCTGG + Intronic
1079605939 11:22366693-22366715 TTATATTTTAAAAAGGTGGCTGG + Intronic
1079948937 11:26777920-26777942 TTTTATTTCCAAAAGTTGGATGG + Intergenic
1080110350 11:28559823-28559845 TAATATTTTCAAACTGTGGTTGG - Intergenic
1081402405 11:42658420-42658442 CAATATTTTCAACAACTGGAGGG + Intergenic
1081892282 11:46553244-46553266 TTACTTTTTAAAAAAGTGAATGG - Intronic
1081953590 11:47069202-47069224 TTATATTTACACAATGGGGAAGG - Intronic
1082178709 11:49092425-49092447 TAATATCTTCCAAAAGTGAATGG - Intergenic
1082611877 11:55310018-55310040 TTATTTTTTTAAAAAATAGATGG - Intergenic
1085072352 11:73558772-73558794 TTATTTTTTAAAAAAGAAGAAGG + Intronic
1085144543 11:74181978-74182000 TTACATTTTTAAAAGGTGGAGGG - Intronic
1085214926 11:74821181-74821203 TTATTTTTTTAAAAAATGGAAGG - Intronic
1085658303 11:78337792-78337814 TTATATTTTAAAAATGTACATGG - Intronic
1086007893 11:82061752-82061774 TTATATTGTTAAAAAGTGGAAGG - Intergenic
1086104220 11:83131969-83131991 GTATATTATTAAAAATTGGATGG + Intergenic
1086428453 11:86711640-86711662 TGGTTTTTTAAAAAAGTGGAGGG + Intergenic
1086699930 11:89889662-89889684 TAATATCTTCCAAAAGTGAATGG - Intergenic
1086706240 11:89954854-89954876 TAATATCTTCCAAAAGTGAATGG + Intergenic
1087445225 11:98242536-98242558 TTATATTTTCCAGTGGTGGAAGG - Intergenic
1087456138 11:98388917-98388939 TTATATTTTCAAAAGGAAGGAGG + Intergenic
1087507723 11:99047943-99047965 ACATATTTTCAAAATGTGTATGG + Intronic
1087520289 11:99224873-99224895 ATTTATTTTGAAAAACTGGAAGG + Intronic
1087539780 11:99501853-99501875 TTTGATTTTAAAAATGTGGAAGG + Intronic
1088246010 11:107818972-107818994 CTCTATTTTAAAAAAGTGGGGGG + Intronic
1088314687 11:108496157-108496179 TTATATTTTTAAAATGGGGATGG + Intronic
1088428194 11:109728566-109728588 TTATTTTTTCACAAAGTGCCTGG + Intergenic
1089242285 11:117092079-117092101 TTATGTTTTTAAAACGTGGCTGG - Intronic
1089894014 11:121909166-121909188 TTATCTTTTCTGAAAGAGGAGGG + Intergenic
1090131146 11:124143348-124143370 CTAAACTTTCAAAATGTGGAAGG + Intronic
1090169701 11:124589894-124589916 TTTTATTTTCAAATACTAGAAGG - Intergenic
1090577401 11:128121189-128121211 TTCTAGTTTCATAAAGTGGAAGG - Intergenic
1090693046 11:129205653-129205675 ATAGATGTTCAAAAAATGGAAGG + Intronic
1090848745 11:130552201-130552223 CTATATTCTCACATAGTGGACGG - Intergenic
1092110284 12:5956262-5956284 TTATATTTTTAATAAGTAGAAGG - Intronic
1093225487 12:16478632-16478654 TTTTAATTTCAGAAAGTGGGAGG + Intronic
1094105167 12:26803554-26803576 TTACATATTCTACAAGTGGATGG + Intronic
1094269254 12:28593164-28593186 TTATATTTTCAAAGTGTTGGGGG + Intergenic
1095251823 12:39988464-39988486 TTATATTTAAAAAAAGAGGAAGG + Intronic
1095438349 12:42216406-42216428 GGATATTTTCAAAAAGAGGGGGG - Intronic
1095669444 12:44841435-44841457 TTATAGTTTCATATAGTGGAAGG - Intronic
1096109214 12:49019254-49019276 TTATTTTTTAAAAAGGGGGAGGG + Exonic
1096140989 12:49242361-49242383 TAATATTTTCTACAAATGGAAGG - Intronic
1096772316 12:53943778-53943800 CTATAGTTTCAAAATGTGGTAGG + Intronic
1097631418 12:62068138-62068160 TTGTATTTTCAAAGTGAGGAAGG - Intronic
1097903987 12:64901582-64901604 TTCAATTTTCAAAAAGTAAAAGG + Intergenic
1098366934 12:69713365-69713387 TAGTATTTTCAAGAATTGGAGGG - Intergenic
1098510326 12:71305572-71305594 TTATAATTTAATAAAGTAGAAGG - Intronic
1098647775 12:72926135-72926157 TATTGTTTTAAAAAAGTGGAGGG - Intergenic
1098684640 12:73403186-73403208 TTTTATATTTAAAAAATGGAGGG + Intergenic
1099294361 12:80811673-80811695 TTGTATTTTCAGAGTGTGGAAGG - Exonic
1100342446 12:93692568-93692590 TGATATGTTCAAAATGTTGATGG + Intronic
1100459254 12:94782644-94782666 TTTTATTTTGAAAATGTGAAAGG + Intergenic
1102541602 12:113623547-113623569 TTATTTTTTGAAAAAGAGAATGG - Intergenic
1103090699 12:118096096-118096118 TTATATTTTCAAAAGGGACAGGG + Intronic
1104204380 12:126623108-126623130 TTTTTTTTTAAATAAGTGGAAGG + Intergenic
1104219169 12:126765467-126765489 GTATATTTTCAACTAGTGCAGGG + Intergenic
1104275498 12:127323304-127323326 TTATATTTTAGAAAACGGGAGGG + Intergenic
1104318542 12:127727262-127727284 TTAGATTCTCAAAAAGTCAATGG - Intergenic
1105266887 13:18827364-18827386 GTTTATTTACAAAAAGTGTATGG - Intergenic
1106274008 13:28186083-28186105 TTGTATTTTGAAAACGGGGAAGG + Intronic
1106394420 13:29366623-29366645 TTATATTTTCAAAACCGTGATGG - Intronic
1106839068 13:33666909-33666931 ACATATATTTAAAAAGTGGATGG + Intergenic
1107068371 13:36242579-36242601 TTATAGTTTCAGAGAGTGAACGG + Intronic
1107163747 13:37262333-37262355 TTATATTTTCAAAGTGAGAAAGG - Intergenic
1108166553 13:47699355-47699377 CTATATTTACTAAAACTGGAGGG + Intergenic
1108193455 13:47967205-47967227 TTAAATTTTTAAAAAGTTGGGGG + Intronic
1108304398 13:49116823-49116845 TTATATTTTACAAGAGTGGTCGG + Intronic
1108551010 13:51544057-51544079 TTATATTTAAAAAATATGGAAGG + Intergenic
1108953993 13:56127419-56127441 TTATATTTTCTAAAATTGCATGG + Intergenic
1109286536 13:60415975-60415997 TTCTATTTTTAAATAGGGGAAGG - Intronic
1109485992 13:63020741-63020763 ATATATTTTCAAAAAAGGAAAGG + Intergenic
1109551934 13:63915303-63915325 TTTATTTTTCAAAAGGTGGAGGG + Intergenic
1109692643 13:65913233-65913255 TTATATTTTCAAAACCCTGAGGG + Intergenic
1109830353 13:67778477-67778499 GTATATTTTCATAAACTGCAGGG - Intergenic
1109973504 13:69801125-69801147 TTATATTTTAAATAAATGTATGG - Intronic
1110232356 13:73180290-73180312 TTTTTTTTTAAAAAAGTAGAAGG - Intergenic
1110889814 13:80684785-80684807 TCACAATTTCAAAAAGTAGAGGG - Intergenic
1110967434 13:81717463-81717485 TTATATTTTTGAAATGAGGAAGG - Intergenic
1111086063 13:83376330-83376352 TTATATTTTCTAAAAATAGATGG + Intergenic
1111181167 13:84667278-84667300 TAATATTTACAAAACATGGACGG + Intergenic
1111351726 13:87039692-87039714 TTATAATTTCAAAAATTCAAAGG + Intergenic
1111816174 13:93156239-93156261 TTATATTTTAAAAGAGAGGAAGG + Intergenic
1112227707 13:97556524-97556546 TTATATTTTAAAAAGGTGATGGG - Intergenic
1112629412 13:101144253-101144275 TTCTTCTTTTAAAAAGTGGAAGG + Intronic
1112890740 13:104227742-104227764 TTATGTTTTCAAAAATTCTATGG + Intergenic
1113730826 13:112640247-112640269 TTTTATTTTGATAATGTGGATGG - Intergenic
1114005762 14:18311703-18311725 TTAAATATTCTAAAAGTGGCCGG + Intergenic
1116265180 14:42679311-42679333 TAATAATTTTAAAAAGTGAAAGG - Intergenic
1116375435 14:44193360-44193382 TTATATGTGCAAAATGTGGTTGG + Intergenic
1116423791 14:44765316-44765338 TTAAATTTTAAAGAAGTGGTAGG + Intergenic
1116585249 14:46695218-46695240 TTATATTTTAAAAATGAGAATGG - Intergenic
1116629259 14:47308426-47308448 TTATTTTTTAAGAATGTGGAAGG - Intronic
1117109215 14:52431407-52431429 TAATATTTTCAGAAAGTGATGGG - Exonic
1117929519 14:60825591-60825613 TTATATCTTCATAAAATAGATGG + Intronic
1117930736 14:60838531-60838553 TTCTAGTTTCTAAAGGTGGAAGG + Intronic
1117933513 14:60873935-60873957 TTATATTGTCAAAAACTAAAAGG - Intronic
1118007110 14:61573330-61573352 TTTTATTTTGGAACAGTGGAAGG + Intronic
1118100627 14:62597290-62597312 TGATATATTCAAAAAGCTGAAGG + Intergenic
1118143877 14:63115181-63115203 TTATATTATAAAAATGTGCAAGG + Intergenic
1118666733 14:68077988-68078010 TTATATGTACATAAGGTGGAAGG + Intronic
1118885181 14:69860124-69860146 TTAGATTTTAAAAAAGTAGAAGG + Intronic
1119579209 14:75760684-75760706 TTATTTTTTAAAAATGAGGATGG + Intronic
1119753116 14:77094784-77094806 TTACAATTTCAAGAAGTAGATGG + Intergenic
1120428132 14:84377199-84377221 TTAGATTTTTGAAAAGTGAATGG - Intergenic
1120531308 14:85634763-85634785 ATATATTTTCAGAAAGTAGCTGG - Exonic
1120657682 14:87214564-87214586 TTATAGTTTCAAAACATGTAAGG - Intergenic
1120865242 14:89290875-89290897 CTTCATTCTCAAAAAGTGGAGGG + Intronic
1121968427 14:98332694-98332716 TTATATTTTAAAAAATTAAATGG - Intergenic
1122333255 14:100943009-100943031 TTATTTTTTAAAAAGGTAGAAGG + Intergenic
1123126370 14:105949000-105949022 TTAAATTTCCTAAAAGAGGAAGG + Intergenic
1125366115 15:38918346-38918368 TTATATGTTCAACAACAGGATGG + Intergenic
1125418889 15:39483037-39483059 TTATAGTTTCATAAATTGAAAGG - Intergenic
1125438219 15:39671477-39671499 TTATATTTTAAAAAACCTGAAGG + Intronic
1125496617 15:40201438-40201460 TTATATTTCCAATAAATTGACGG - Intronic
1126337234 15:47599454-47599476 TTTTTTTCTCAAAAAGTAGATGG + Intronic
1126586980 15:50298654-50298676 TGTTATTTTCAAAAAGAGGCTGG + Intronic
1126802029 15:52306924-52306946 TTAGATTTTCAAAAGATTGAGGG - Intergenic
1127879293 15:63142303-63142325 TTAAAAATTCAAAAAGTGGCTGG - Intronic
1129768168 15:78183278-78183300 TTATGTTTACAAAAAGAGGCCGG + Intronic
1129853402 15:78808580-78808602 AAATATTTTTAAAAAGTGCAGGG + Intronic
1130177318 15:81587246-81587268 TAGTATTTTCAAATTGTGGAAGG - Intergenic
1130313752 15:82777540-82777562 TGATATTGTCAAAAAGTGAAAGG + Intronic
1131327929 15:91466912-91466934 TTATATTTTAAAAATTTTGATGG + Intergenic
1132136291 15:99343242-99343264 TTATTTTATCAAAAGGTGAATGG - Intronic
1132151409 15:99463099-99463121 TTATATTTTCAAACATTTGGAGG - Intergenic
1132288436 15:100682808-100682830 TCATATTTTCAGCAAGAGGAAGG - Intergenic
1134474006 16:14555221-14555243 TTTTATTTAAAAAACGTGGAAGG - Intronic
1135829995 16:25764556-25764578 TGATATTTTCAAACAGTGGCTGG - Intronic
1136735145 16:32460749-32460771 TTTTATTTTCAAAAATTGTGTGG - Intergenic
1136777161 16:32878084-32878106 GTATATTTCTAAAAAGAGGAAGG - Intergenic
1136893460 16:33983429-33983451 GTATATTTCTAAAAAGAGGAAGG + Intergenic
1137995287 16:53204224-53204246 ATAAATTTTCAAAAAGAGAAGGG - Intronic
1138030523 16:53556148-53556170 TTATTGTTTCAAAAAGGGAAAGG - Intergenic
1138323620 16:56141721-56141743 TTATATTTTTAAAAGGTTTAAGG - Intergenic
1138873133 16:60917170-60917192 TCATATTCTCAAAAAGTGATAGG + Intergenic
1138890059 16:61130829-61130851 TTATATTTACAACACATGGAGGG + Intergenic
1139279848 16:65761022-65761044 TTGTCTTTTCAAAAAGTGTCAGG + Intergenic
1139333822 16:66216533-66216555 ATATTTTTTTAAAAAGTGGCTGG + Intergenic
1139837996 16:69855246-69855268 CTATATTTTCAATAAGTTAAGGG - Intronic
1140061252 16:71571470-71571492 ATATATTTGTAAAAAGTGCAGGG + Intronic
1140819885 16:78653347-78653369 TTACTTTTACAAAAAGTGTAAGG - Intronic
1142014418 16:87736951-87736973 TTATATTTTTAATAAGAGGCAGG - Intronic
1203017934 16_KI270728v1_random:368843-368865 TTTTATTTTCAAAAATTGTGTGG + Intergenic
1203036269 16_KI270728v1_random:642001-642023 TTTTATTTTCAAAAATTGTGTGG + Intergenic
1203079576 16_KI270728v1_random:1140193-1140215 GTATATTTCTAAAAAGAGGAAGG - Intergenic
1143300644 17:5908209-5908231 TGATGTATTTAAAAAGTGGAGGG - Intronic
1144046101 17:11456152-11456174 GCACATTTTCAAAAAGTGGTGGG + Intronic
1145290807 17:21544338-21544360 TTAGATGTTCAAAAAGTGGTGGG - Intronic
1147504997 17:41007159-41007181 TTAGAGACTCAAAAAGTGGAGGG + Intergenic
1147954376 17:44123971-44123993 CTTTCTTTTCAAAACGTGGATGG + Intergenic
1148259180 17:46164922-46164944 TTATCATTTCATAAAGTGGTGGG - Intronic
1148292836 17:46471335-46471357 GTATATTTTCGGTAAGTGGAAGG - Intergenic
1148315020 17:46689032-46689054 GTATATTTTCGGTAAGTGGAAGG - Intronic
1149173407 17:53840933-53840955 ATATATGTTCAAAAATTGCATGG - Intergenic
1149745817 17:59096730-59096752 TTATATTCTGAAGAAATGGAAGG - Intronic
1150363377 17:64558753-64558775 TTATACTTTGAAAAATTTGAAGG - Intronic
1151112849 17:71699723-71699745 TTATACATTCAAAAATTGGTGGG + Intergenic
1153664468 18:7356479-7356501 TTATATTTGCCAAAAGTGAGAGG + Intergenic
1154079186 18:11237390-11237412 TTCTATTTTCAAAAATTGTTGGG - Intergenic
1154229881 18:12546326-12546348 TTATTTTTTAAAAAATTGAATGG - Intronic
1154336186 18:13466826-13466848 TTATATCTTCACATGGTGGAAGG + Intronic
1154421519 18:14234092-14234114 GTTTATTTACAAAAAGTGTATGG + Intergenic
1154531666 18:15352178-15352200 TTAAATATTCTAAAAGTGGCCGG - Intergenic
1154973061 18:21429567-21429589 AAATTTTTTCAAAAAGTAGAAGG - Intronic
1155004958 18:21720495-21720517 TTTTTTTTTTAGAAAGTGGAAGG + Intronic
1155058715 18:22208941-22208963 TTCTATTTTCAATCAGTGGGAGG - Intergenic
1156107566 18:33683607-33683629 TTATATTATGATGAAGTGGAAGG + Intronic
1156182174 18:34617978-34618000 TTATATTATCAAAAAGATGAAGG - Intronic
1156207626 18:34903661-34903683 GCAAATTTTCAAAAAGTGAAAGG - Intergenic
1156235072 18:35195163-35195185 TTTTATTTTAACAAAGTGTATGG - Intergenic
1156561545 18:38131136-38131158 TTATATCTTCAAGAAGGAGAAGG - Intergenic
1156579982 18:38363653-38363675 TTGTGTTTTCAAATGGTGGAAGG - Intergenic
1156581535 18:38382239-38382261 TTGTGTTTTCAAATGGTGGAAGG + Intergenic
1157643020 18:49236833-49236855 TTATATTTGCAAAGAGCAGATGG - Intronic
1158052417 18:53239270-53239292 TTATAGTTACAGAAACTGGAGGG + Intronic
1158928271 18:62293666-62293688 TTATACTGTCACAAAGTTGATGG + Intronic
1159332179 18:67010265-67010287 TTACATTTTTAGAAACTGGAAGG - Intergenic
1159436143 18:68420299-68420321 ATATATTTTCAGAAAATTGAAGG - Intergenic
1160007159 18:75075931-75075953 CTATCTTTGCAACAAGTGGATGG + Intergenic
1162505719 19:11083514-11083536 ATATATTTTTAAAAAGTAGCTGG - Intergenic
1163813537 19:19449494-19449516 TTTTATTTTTAAAACGTTGATGG + Intronic
1164304481 19:23993047-23993069 TTATATTTACAAAAAATTGCTGG + Intergenic
1164333122 19:24280113-24280135 TTAATTTTTTAAAAAGTGTAAGG - Intergenic
1165456256 19:35912614-35912636 TTATATTTTTAAAAATAGGCTGG + Intergenic
1166286290 19:41831698-41831720 TAATATTTTTAAGAAATGGATGG - Intergenic
1167226830 19:48249900-48249922 TTTTGTTTTCAACAAGCGGAGGG - Intronic
1167287339 19:48605845-48605867 TTTTATTTTAAAAAATTGGCCGG - Intronic
925378654 2:3407905-3407927 TTATAATTTCAAATAGCAGACGG + Intronic
925426167 2:3750538-3750560 TGATATTTTCAAAATCTAGAAGG - Intronic
925717226 2:6795621-6795643 TAATTTTTTTAAAAAGGGGATGG - Intergenic
926656420 2:15412027-15412049 TACTATTTTTAAAAAGAGGAAGG + Intronic
926937312 2:18098965-18098987 TTATATATTCAAAGAGGTGATGG - Intronic
927448319 2:23185226-23185248 CTATATTTTAAAAAAATGGCTGG - Intergenic
927623701 2:24689867-24689889 ATATATGCTCCAAAAGTGGAGGG + Intronic
928049925 2:27980753-27980775 TTATATATTCAAATACTGGTTGG + Intronic
928216651 2:29367043-29367065 TTGTATTTTCAAAAAGAGGACGG - Intronic
930194769 2:48498010-48498032 TTATATTTTAATTAAGTGGATGG + Intronic
930431895 2:51288379-51288401 ATGTGTTTTCCAAAAGTGGAAGG - Intergenic
930987044 2:57602596-57602618 CTTTATTTACAAAAAGTAGATGG - Intergenic
931182122 2:59913209-59913231 TTATATTTTCAAAGAGTGAGAGG + Intergenic
931497187 2:62820810-62820832 GGATATTTTCAAAAAGTGAAGGG + Intronic
932099043 2:68879888-68879910 TGATATTTTCAAAGGGAGGACGG - Intergenic
932508554 2:72261717-72261739 TTATATTTTCATATATTTGAAGG + Intronic
932887101 2:75558499-75558521 TTATTTTTTAAAAAAAAGGAGGG + Intronic
933219629 2:79673362-79673384 TTATATTTTTAAAAAGATAAAGG - Intronic
933279490 2:80317372-80317394 TTGTATATTCTGAAAGTGGAAGG - Intronic
933291085 2:80439018-80439040 TTTTATTATCAAAAAGAGAAAGG - Intronic
933460482 2:82577445-82577467 CTATATTTTCTAAAAATGTATGG + Intergenic
934156859 2:89210037-89210059 TTATGATTTCATATAGTGGATGG - Intergenic
934210460 2:89972712-89972734 TTATGATTTCATATAGTGGATGG + Intergenic
934496620 2:94807007-94807029 GTTTATTTACAAAAAGTGTATGG - Intergenic
934687064 2:96328826-96328848 TTATATTTTCAAAATAGTGAAGG - Exonic
934939632 2:98491133-98491155 TTGTATTTCCAAAAAGGGGGCGG + Intronic
935283267 2:101538231-101538253 TTATTTTTTTAAAAAAAGGAAGG + Intergenic
935352560 2:102165994-102166016 TTATATTTTTAGAAAGTGACTGG - Intronic
935507765 2:103927931-103927953 TTATTCTTTCATAAAGTGCAAGG + Intergenic
935966995 2:108489024-108489046 TTATATTATAAGAAAGTAGAAGG - Intronic
936027666 2:109046002-109046024 TTATATTTTAAAAAAATCCAAGG + Intergenic
936688120 2:114852389-114852411 ATATTTTTTTAAAAAATGGATGG + Intronic
937171589 2:119876751-119876773 TTATATCTTTAAAAATTGGTGGG + Intronic
938530760 2:132183423-132183445 TTAAATATTCTAAAAGTGGCCGG - Intronic
939106796 2:137958008-137958030 TTATCTTTTTAAAAGATGGAAGG + Intergenic
939696362 2:145329634-145329656 TTGTATTTTCACTAAGAGGAGGG + Intergenic
939898560 2:147822525-147822547 AAATATTTTCAAAAAGTTAAAGG + Intergenic
940061035 2:149568441-149568463 TTTTATTTTCATAATTTGGAGGG - Intergenic
940100202 2:150028735-150028757 TTCTATTTTCCAAAAGATGAGGG - Intergenic
940144848 2:150534887-150534909 TTCTATTTACAAAAAATGGGTGG + Intronic
940670141 2:156657478-156657500 AAATATTTTTAAAAAGTTGAAGG + Intergenic
941020311 2:160401153-160401175 ATGTATTTTTAAAAACTGGAAGG - Intronic
941128544 2:161617438-161617460 TTTCATTTTTAAACAGTGGATGG + Intronic
941159398 2:162019018-162019040 TGATATTTCCAAACAATGGAAGG - Intronic
941175274 2:162190677-162190699 TTATATTTTAAAAGAGGGGCTGG + Intronic
941347964 2:164393229-164393251 TTAAAATTTCAAAAAGCAGATGG - Intergenic
941471144 2:165888816-165888838 ATATCTATTCAAAAAGTGAAAGG + Intronic
941558008 2:167007837-167007859 GTACATTTTTAAAATGTGGAAGG + Intronic
942210642 2:173665837-173665859 TTATACGTTCAAAAAATGTAAGG + Intergenic
942442974 2:176055187-176055209 TTGTATCTTCACATAGTGGAGGG + Intergenic
942743252 2:179203421-179203443 CTATTTTTTAAAAAAGGGGAGGG + Intronic
942858097 2:180576326-180576348 TAATATTTTCAAAATGTTGTAGG - Intergenic
943247624 2:185474929-185474951 TTAAAATTTAAAAGAGTGGAAGG - Intergenic
943363196 2:186945568-186945590 ATATATTTTTAAAAAGAAGAGGG - Intergenic
943406002 2:187486359-187486381 TTATGTTTGCCAAAAGTGGATGG + Intronic
943428365 2:187765362-187765384 TTATATTTTAATAAAGTTCAGGG + Intergenic
943617886 2:190114788-190114810 TTATATTTTCAAAGTTTGGAAGG - Intronic
943820217 2:192313232-192313254 TAATTTTTGCAGAAAGTGGAAGG + Intergenic
943898571 2:193401974-193401996 TTTTTTTTTCATAAAGTGTAAGG + Intergenic
943942462 2:194016737-194016759 TTAAATTTTTAAAAAGTGTTAGG + Intergenic
943977329 2:194500686-194500708 GTATATTTTTAAACTGTGGAGGG + Intergenic
944009206 2:194952797-194952819 TTAAATGTTCACAAAGTGGCTGG + Intergenic
944027430 2:195188085-195188107 AGATATTTTCAGAAAGTGAAGGG + Intergenic
944075697 2:195728420-195728442 TTATATTTTCAAAAATAGTTTGG - Intronic
944201799 2:197115664-197115686 TTAGATTTTCCAAAAGTTGAGGG - Intronic
944338828 2:198570302-198570324 GTATACTTTCAAAAGGTTGAAGG + Intronic
944900136 2:204205552-204205574 GTATATTTTTAAAATGTGGAGGG + Intergenic
944945159 2:204676055-204676077 TTATAAGTTCAAAGACTGGAAGG - Intronic
945354180 2:208817763-208817785 TTATATTTTTTAAAACTTGAAGG + Intronic
945685180 2:212960081-212960103 TTATCTTTTCAAAGAAAGGAAGG + Intergenic
945913842 2:215681847-215681869 TTATCTTTTCAAAATGTGATTGG + Intergenic
946390297 2:219411292-219411314 TTTTTTTTTAAAAAAGTGGCCGG + Intergenic
946697108 2:222370951-222370973 TAATATCTTCAAAATGTTGAAGG + Intergenic
946721863 2:222617333-222617355 TTCTATTTTATATAAGTGGAAGG - Intronic
946812165 2:223537492-223537514 TTATATACACAAAAAGTGGCTGG + Intergenic
948591196 2:239051316-239051338 TTCTATTTTCAGAAAGTGAGAGG - Exonic
1169452435 20:5723515-5723537 TTAAATTTTAAAAAAGAGGCCGG + Intergenic
1169606402 20:7324532-7324554 TCATATTTTCAAAGTGTGGGTGG + Intergenic
1169634796 20:7677471-7677493 TTTTATTTACAAAAGGAGGAAGG - Intergenic
1169845403 20:9986238-9986260 CTATATTTTCAAAAGGGAGATGG + Intronic
1170116621 20:12866753-12866775 ATATATTTTTAAAAAATAGATGG - Intergenic
1170187579 20:13608327-13608349 TCAAATTTTCAAGAATTGGATGG + Intronic
1170368681 20:15624619-15624641 TTATATTTTAAAAATGGGCATGG - Intronic
1170608057 20:17888491-17888513 ACACATTTTCAAAAAGGGGAGGG + Intergenic
1170659378 20:18321930-18321952 TTTTTCTTCCAAAAAGTGGAAGG + Intergenic
1171887918 20:30673739-30673761 GTTTATTTACAAAAAGTGTATGG - Intergenic
1172415147 20:34759358-34759380 TTAAATTTTAAAAAGGTAGATGG - Intronic
1173209015 20:41017393-41017415 TTATGTTTTCCAAAAATAGAAGG + Intergenic
1174175946 20:48644964-48644986 TTTAATTTTCAAAAAGGTGAAGG - Intronic
1174237612 20:49106976-49106998 TTTTTTTTTCAAAAAGTGGGTGG - Intergenic
1176765691 21:13015990-13016012 TTAAATATTCTAAAAGTGGCCGG + Intergenic
1176851953 21:13925860-13925882 GTTTATTTACAAAAAGTGTACGG - Intergenic
1176914010 21:14603480-14603502 ATACAGTTTGAAAAAGTGGAAGG + Intronic
1176946786 21:14991716-14991738 TCAAATTTTCAAAAAGTAAATGG + Intronic
1176970934 21:15264930-15264952 TTATAATTTCAAAGTGGGGATGG + Intergenic
1177365600 21:20131735-20131757 TTATATTTACAATAAATGAATGG + Intergenic
1177430356 21:20984681-20984703 TTATAATTTCTAAAAGTGTATGG - Intergenic
1177509705 21:22069415-22069437 TTATATTTTCAAAAAGGTCTAGG + Intergenic
1177911304 21:27036063-27036085 TTATATTTAGAAACAGAGGAAGG + Intergenic
1177939801 21:27395447-27395469 TTATATCTTCAAAATATGCATGG + Intergenic
1178058916 21:28830569-28830591 TTATTTTTTAAAAAAATGTATGG + Intergenic
1178686297 21:34713343-34713365 ATATATTATCACAAAGGGGATGG + Intronic
1178960548 21:37060720-37060742 TTATATTTTCACACAATGCAGGG - Intronic
1180430270 22:15242510-15242532 TTAAATATTCTAAAAGTGGCCGG + Intergenic
1182057094 22:27367844-27367866 TAATATTTTCAAAGTGTTGAGGG - Intergenic
1182680099 22:32072575-32072597 TTATATTTTTTAAAAGTCAAAGG - Intronic
1182991039 22:34768031-34768053 TATTATTTTCAGAAAATGGAAGG + Intergenic
1184356432 22:43983321-43983343 TCAATTTTTCAGAAAGTGGATGG + Intronic
1184925562 22:47634274-47634296 TTAAGTTTTTAAAAAGTGAAAGG - Intergenic
949973410 3:9431386-9431408 TTACATTTGCATAAAGTGGTTGG + Intronic
951060962 3:18206840-18206862 TTTTATTTTCAAAATGGGAAAGG + Intronic
951339466 3:21467237-21467259 TTACATTTTGAAAAAGTTTATGG - Intronic
951831494 3:26933351-26933373 ATATATTTTTAAAAAGTGCTGGG - Intergenic
951954011 3:28233956-28233978 TTAGATTTTCAACAAGAGAAAGG - Intergenic
952081402 3:29761976-29761998 TTTTATTTTATAAAATTGGATGG - Intronic
952320616 3:32274401-32274423 TTTTATTTTAAAAAAGTTCAAGG + Intronic
952356267 3:32587300-32587322 ATATATTTTTAAATAGTGAAGGG - Intergenic
952579313 3:34812547-34812569 TTATCTTGCCAAAAAGTAGAGGG + Intergenic
952632443 3:35485886-35485908 CTATATCATCCAAAAGTGGACGG - Intergenic
952836242 3:37604778-37604800 TAATAGTTTCAGAAAGTTGAGGG + Intronic
952923413 3:38304336-38304358 GAATATTTTCAAAATGTGGATGG - Intronic
953121525 3:40047432-40047454 TTTTATTTTAAGAAAGTGGAGGG + Intronic
953233001 3:41081100-41081122 TGATATTTTGAAACAGTGGCAGG - Intergenic
953873904 3:46653384-46653406 TAATTTTTGCAAAAAGTGTAAGG - Intergenic
954905585 3:54059798-54059820 ATAAATCTTCAAAATGTGGAAGG - Intergenic
954963253 3:54585226-54585248 TTATATTTTAAAAGTGTGAAGGG + Intronic
954975831 3:54693546-54693568 TTTTCTTTTCAATAAGTAGATGG - Intronic
955082126 3:55667613-55667635 TTATTATTTCCAAAACTGGAAGG - Intronic
955210621 3:56937041-56937063 TGGTCTTTTCAAAAACTGGAGGG + Intronic
955473148 3:59307832-59307854 TTAAATTTTCTAAAAGGGGTGGG + Intergenic
955967629 3:64405343-64405365 TTATGTTTTCAAACAAGGGATGG - Intronic
956303094 3:67793775-67793797 TAAAATTTTTAAAAAGAGGATGG - Intergenic
956757077 3:72399286-72399308 ATATATTTTCAACAAGTGGTTGG + Intronic
957425734 3:80036684-80036706 TGAAATTTTTAAAAACTGGAAGG + Intergenic
957592193 3:82213927-82213949 GCATATTTTCAAGAAGTGGAAGG - Intergenic
957709497 3:83837605-83837627 TTATAGTATAAAAGAGTGGATGG - Intergenic
957911825 3:86628384-86628406 TAATATTTTCAAAAAAATGAAGG - Intergenic
958612175 3:96440287-96440309 TTATATTTTTAAAAAGAACACGG - Intergenic
958804723 3:98795836-98795858 TTATTTTTTTAAAAAAAGGATGG + Exonic
958953612 3:100442763-100442785 TTTTATTTTTAAAAAAAGGAGGG - Intronic
959057183 3:101579060-101579082 TCATAATTTCAAACAGTAGAAGG - Intronic
959258611 3:104047543-104047565 TTATATTTACAAAATGTAGAAGG - Intergenic
959309685 3:104717921-104717943 TTATTTTTACAGAAAGAGGAAGG - Intergenic
959574812 3:107923488-107923510 TAAAATTTTCAAAGAATGGAAGG + Intergenic
959847758 3:111054386-111054408 TGATATTTTCAAATAGTGAATGG + Intergenic
960200625 3:114831126-114831148 TTATATTTTAAAAAGGTTGGAGG - Intronic
960476247 3:118132332-118132354 TTATATATTGAAAAACTGGCTGG - Intergenic
961559967 3:127721960-127721982 TTACATATTTAAAAGGTGGAAGG + Intronic
962569724 3:136700747-136700769 TCATATTTTCAGTAACTGGAAGG - Intronic
962606754 3:137038422-137038444 ACATATTTTCATAAAGTAGAAGG - Intergenic
963519581 3:146347310-146347332 AGAGATTTTCAAAAAGGGGAGGG - Intergenic
964465765 3:156990153-156990175 TTTTATTTTTAAAAAGTGTGAGG - Intronic
964600937 3:158500233-158500255 TTATCTTTTCAAAATGTTGTTGG + Intronic
964610861 3:158613537-158613559 TTCTATCTTCACATAGTGGAAGG + Intergenic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
965386501 3:168052539-168052561 TTTTATTTTCAAAAACTTAAGGG - Intronic
965847781 3:172984963-172984985 TTAATTTTCCAAAAAGTAGATGG + Intronic
965902639 3:173661563-173661585 TTCTTTTTTCAAATGGTGGAAGG - Intronic
966737845 3:183203298-183203320 TTACATGTTCAAAAAGTTAAAGG + Intronic
967125111 3:186416230-186416252 CTTTATTTACAAAAAGTGGTGGG - Intergenic
967256333 3:187595939-187595961 GTATATTTTCAATTAGTGTAAGG - Intergenic
969693453 4:8720952-8720974 GTAACTTTTCACAAAGTGGAAGG - Intergenic
969976723 4:11110261-11110283 TTTTATTTTAAAAATGGGGATGG + Intergenic
970090786 4:12405642-12405664 TTATATTATCAAACATTGGGTGG + Intergenic
970328478 4:14953957-14953979 AAATATTTTCAAAACTTGGAGGG - Intergenic
970677478 4:18467980-18468002 ATATATTTTCAAATTGTTGATGG + Intergenic
970785921 4:19795971-19795993 TTTTATTTTCAAAAAGAAAATGG - Intergenic
970925655 4:21448870-21448892 TAATATTCTCAAAAACTTGATGG - Intronic
971073207 4:23118439-23118461 TGATATTTTCACAAAGTATAGGG + Intergenic
971596902 4:28540733-28540755 ATATATTTTTAAAAATTGGTAGG - Intergenic
971713361 4:30145815-30145837 CTCTATTTTCACATAGTGGAAGG + Intergenic
972776974 4:42250372-42250394 TTACATTTTTAAAAAGTTGCGGG - Intergenic
974206898 4:58715816-58715838 TTGTTTATTCAAAAAATGGAGGG - Intergenic
974229873 4:59096910-59096932 TTGTATTTTCAAAAACTTTAAGG + Intergenic
974378802 4:61111279-61111301 TTATTTTTTAAAAAACTGGCTGG - Intergenic
974613647 4:64251294-64251316 TTATATGTTGAAATAGTGTAGGG - Intergenic
974920200 4:68229779-68229801 TTAAATGTTCAGAAACTGGATGG - Intronic
975196912 4:71536345-71536367 TTTTATTTTCCAAAAATGGCTGG - Intronic
975332608 4:73134597-73134619 TTATTTCTTCAAAAAGTGCCTGG + Intronic
975508207 4:75162769-75162791 TTAATTTTTTAAAAAGTGGTAGG + Intergenic
975865615 4:78720897-78720919 TTATATTCTAAAATAATGGAAGG + Intergenic
976862384 4:89681184-89681206 TTATATTTTCAAACTTTAGAAGG - Intergenic
977083090 4:92558520-92558542 TTATATTTTTAAAGAATGGACGG - Intronic
977196618 4:94069988-94070010 ATATATTTTTAAAAAGGAGAAGG - Intergenic
977207576 4:94180504-94180526 TGATAATTTTCAAAAGTGGAAGG + Intergenic
977256026 4:94740930-94740952 TTCTAATTTAAGAAAGTGGATGG - Intergenic
977752238 4:100623315-100623337 ATATATGTTCAAAAATTGTATGG - Intronic
977860808 4:101957598-101957620 GGAAATATTCAAAAAGTGGAAGG - Intronic
978048735 4:104168229-104168251 TTATATCTTCACGTAGTGGAAGG - Intergenic
978124064 4:105114622-105114644 TTATAGTTTAAAAAAGAGAAAGG + Intergenic
978329334 4:107595666-107595688 TTATATTTTCAAAAAAGGTCTGG + Intronic
978351162 4:107822350-107822372 TTATATTTTAAAAATTTGGGGGG + Intergenic
978932969 4:114338845-114338867 TCATATTTTTAAAAGGTGGCTGG + Intergenic
979071246 4:116209409-116209431 TGATCTTTTAAAAAAGTGGCCGG - Intergenic
979969757 4:127119826-127119848 ATATATATTCAAAAATTGGCTGG - Intergenic
980145293 4:128975337-128975359 TTTTATTTTTAAAAAGTTGTTGG - Intronic
981501014 4:145451957-145451979 TTACATTTTCACAACTTGGAGGG - Intergenic
981620248 4:146688536-146688558 TTGTATTTTCAAAATCTGTAGGG + Intergenic
981789861 4:148523861-148523883 TTATATTTTCAAAAATTTCCTGG + Intergenic
982079996 4:151779987-151780009 TTCTATCTTCTAAAAATGGAAGG + Intergenic
982118517 4:152117364-152117386 GTATTTTTTCAAACAGTGAAAGG - Intergenic
982439941 4:155423597-155423619 CCATATTTTCAAAAACTGTATGG + Intergenic
982505937 4:156218269-156218291 TTATATTTTAACAAAGAGGCTGG + Intergenic
982628284 4:157796749-157796771 TTTTATTTTCCAAATGTGAATGG - Intergenic
982905522 4:161064512-161064534 GTATTTTTTTAATAAGTGGAAGG + Intergenic
983145863 4:164214474-164214496 TTAGACATTTAAAAAGTGGAGGG - Intronic
983200550 4:164856210-164856232 ATATATTCTTAAAAATTGGAAGG - Intergenic
983475822 4:168210645-168210667 TTATATTTTAAATGTGTGGAGGG + Intergenic
984015445 4:174420499-174420521 TTATTTTTGCAAAGAGTTGAGGG - Intergenic
984466775 4:180109938-180109960 TTAGGTCTTCAAAAAGTGCATGG + Intergenic
985228710 4:187790716-187790738 TTGTTTTTTCAAAAATTAGATGG + Intergenic
986133241 5:4949869-4949891 TAATTTTTTTACAAAGTGGAAGG + Intergenic
986780143 5:11057895-11057917 TTATATTTTAAAAAAGAGACTGG + Intronic
986888738 5:12273871-12273893 TTATTTTTTCAAAAAAAGAAAGG + Intergenic
986941868 5:12962371-12962393 TTATATATGCAAAATGTGTAAGG + Intergenic
986962170 5:13227472-13227494 TTATATTTTGAAAAATTGAAAGG - Intergenic
987378810 5:17264155-17264177 TTCTATTTTCAACAAGTGACTGG - Intronic
987390661 5:17372196-17372218 TAATATATTTAAAAAATGGATGG + Intergenic
987567284 5:19607500-19607522 TAAAATTTTTAAAAAGTGAATGG + Intronic
987961612 5:24817099-24817121 TTATATTTTCCTATAGTGCAGGG - Intergenic
987969440 5:24923154-24923176 TCTTATTTTTTAAAAGTGGAAGG + Intergenic
988339853 5:29957012-29957034 TGATATTTTCAAAATTTTGAAGG - Intergenic
988458097 5:31405783-31405805 TTTTTTTTTCAAAAAATGCAAGG + Intronic
988972231 5:36480867-36480889 TTTTTTTTTAAAAAAGAGGAGGG + Intergenic
989281890 5:39654034-39654056 ATATATGTTCAAAAATTGAATGG + Intergenic
989949045 5:50275364-50275386 TTATATCGTCACATAGTGGAGGG + Intergenic
990670163 5:58119744-58119766 TTTTACTTTCAAAGAGTGCAAGG - Intergenic
990765825 5:59181438-59181460 TTATATTTCAAAAATGTTGATGG - Intronic
990972278 5:61521644-61521666 TTATATTCTCAGAATATGGATGG + Intronic
991057545 5:62335891-62335913 TTATAGTTTCAAAAACTCTATGG - Intronic
991319039 5:65348112-65348134 TTATAATTTTAAAATTTGGAGGG - Intronic
992212951 5:74498070-74498092 TTATATGTTCAATAAATGTATGG + Intergenic
992462759 5:76977326-76977348 TTATGTTTTCTACAAGTAGAAGG + Intronic
992730892 5:79667501-79667523 TTTTAATGTCTAAAAGTGGAGGG - Intronic
992791756 5:80220282-80220304 TTGTAATTTTAAAAAGTAGAGGG - Intronic
993204838 5:84865146-84865168 TTATATTTTCAGAAATTGTGAGG - Intergenic
993376656 5:87156552-87156574 GTATACTTTCAAAAAATGCAGGG + Intergenic
993597847 5:89881831-89881853 TTGTGTTTTCACATAGTGGAAGG + Intergenic
993601564 5:89932311-89932333 TTTTATTTTCAAAAATGGGGTGG - Intergenic
993778700 5:92037479-92037501 TTTTATTATCAAAAATTTGATGG - Intergenic
993783960 5:92105732-92105754 TTATAGTTTCAAAAAATTAAAGG + Intergenic
993788886 5:92181625-92181647 TTATATTTTCAAATAGTTATTGG - Intergenic
993806172 5:92412639-92412661 CTCTATCTTCATAAAGTGGATGG - Intergenic
994006015 5:94838018-94838040 GTGTATTTCCAAAAAATGGAAGG - Intronic
994045036 5:95298204-95298226 TAATAATTACAAAAAGTGAAGGG + Intergenic
994131032 5:96227700-96227722 TTTTATTTTCAAAAATTACATGG + Intergenic
994177386 5:96725814-96725836 TTATATTTGCATAAACTGAAAGG + Intronic
994227359 5:97268365-97268387 TTAAATTTAAAAAAAGAGGAGGG - Intergenic
994558617 5:101337100-101337122 TTTTTTTTTCCAAAAGTAGATGG - Intergenic
994577784 5:101602188-101602210 TCATATTTTCAAATTGTTGATGG - Intergenic
995007160 5:107213442-107213464 ATATAGTTTCAAAAACTAGAAGG + Intergenic
995234677 5:109814174-109814196 TTATATCTTCAGAATGGGGAGGG - Intronic
995396365 5:111691331-111691353 TAAAACTTTTAAAAAGTGGAGGG + Intronic
995516738 5:112961888-112961910 TTAATTTTACAAAAAGTGAACGG + Intergenic
995634205 5:114166892-114166914 TTGTATCCTCAAATAGTGGAGGG - Intergenic
996307803 5:122069883-122069905 TTATTTTTTTAAATAATGGAAGG - Intronic
996882787 5:128319840-128319862 TTCTACTCTCAAAAAGAGGATGG + Intronic
997129955 5:131266627-131266649 TTGTATTTTCAAAAAGAGACGGG + Intronic
997191805 5:131944966-131944988 ATTTATTTTTAAAAAGGGGAAGG - Intronic
998063416 5:139137050-139137072 TTACATTTCCACAAAGTGGAAGG - Intronic
998440698 5:142159343-142159365 TTATGTCTCCAAAAAGTGGTTGG + Intergenic
998893944 5:146778027-146778049 TTAAACTCTTAAAAAGTGGAAGG - Intronic
999360032 5:150976346-150976368 TTGTATTTTCAAAAGGAGTAAGG - Intergenic
999375257 5:151081926-151081948 TTTTAATTCCAAAAAGTGGAAGG + Intronic
999518226 5:152322259-152322281 TTTTATTTACAAAAACAGGAGGG - Intergenic
999602483 5:153282532-153282554 TTATATTTTAAAAAAAGGGGAGG + Intergenic
1002946707 6:1768328-1768350 GGATATGTTCAAAAAGTGCAAGG + Intronic
1003534410 6:6963767-6963789 TCTTATTTTTAAAAAGGGGAGGG - Intergenic
1003597943 6:7491205-7491227 ATATTTTTTCAAAGAGTGAATGG - Intergenic
1003679647 6:8239465-8239487 TTGTATTTTCAAATAGGGCATGG + Intergenic
1003719490 6:8684900-8684922 ATATATTTTCAAAATTAGGAAGG - Intergenic
1005381290 6:25236895-25236917 AGATATTTTTAAAAAATGGATGG - Intergenic
1005793934 6:29337100-29337122 TTATATTTTGAAAAAGAGTATGG + Intergenic
1005923525 6:30420390-30420412 TAATTTTTTAAAAAAGTGGCCGG + Intergenic
1006235217 6:32624950-32624972 TTATATTTATAAAAACAGGAAGG + Intergenic
1006279163 6:33033520-33033542 TTCTAATTTCTTAAAGTGGAAGG + Intergenic
1006758171 6:36436013-36436035 TTATTTTTTGAAAAAGTTTATGG - Intronic
1007007794 6:38383303-38383325 TTAAATTTTTAAATAGTGGTTGG - Intronic
1007087746 6:39161557-39161579 GTATATTTTCAACAAATGGTAGG + Intergenic
1008287671 6:49673672-49673694 ATATAATTTTAAAAAATGGAAGG + Intergenic
1008511817 6:52283125-52283147 TTTTTTTTTCAAAAAGTGGGTGG - Intronic
1008705694 6:54156281-54156303 CTGTATTTTTAAAAATTGGATGG - Intronic
1008956337 6:57220847-57220869 TTATTATTTTAAAAAGTGTATGG - Intronic
1009056943 6:58347581-58347603 TTATATTTTCTTTAAGTGAAGGG + Intergenic
1009234300 6:61103987-61104009 TTATATTTTCTTTAAGTGAAGGG - Intergenic
1009330058 6:62407647-62407669 TTATATTTTGAAAAACTAGAAGG + Intergenic
1009989839 6:70828656-70828678 TTCTATTTCCACAATGTGGAAGG - Intronic
1010416089 6:75613202-75613224 TTATATTTTTAATGACTGGAGGG + Intronic
1010578868 6:77568825-77568847 AGAAATTTTCAAAAATTGGAAGG - Intergenic
1010756368 6:79670193-79670215 TTATATTTTTAAACAGTTGGGGG - Intronic
1010776144 6:79888070-79888092 TTAGATTATAAACAAGTGGATGG + Intergenic
1011381558 6:86747321-86747343 TTATCTTTTGAAAAAATGGCTGG + Intergenic
1011535625 6:88372962-88372984 TTAGTCTTTTAAAAAGTGGATGG - Intergenic
1012018445 6:93884064-93884086 TCATATTTTTAAAACGTGGGAGG - Intergenic
1012150537 6:95745180-95745202 TTAAATCTTCAAAGAATGGAAGG - Intergenic
1012509757 6:99989772-99989794 TTATATTTTCAAAAAGTGGAAGG - Intronic
1012589831 6:100967598-100967620 TTTAATTTTCATAAAGTGGGAGG + Intergenic
1013018680 6:106187068-106187090 TTACATTTTCAAAATATGTATGG - Intronic
1013192790 6:107818030-107818052 CTATATTTTCACACCGTGGATGG + Intronic
1013232786 6:108171838-108171860 TAATAATTTAAAAAAGTGTAGGG - Intronic
1013399859 6:109782450-109782472 TAATATTTTTAAAAAGTTTATGG + Intronic
1014397996 6:120950458-120950480 TTAAATATTCAAAAAGTAGCTGG + Intergenic
1014654728 6:124087051-124087073 ATATATTTTAAAAATGTAGATGG + Intronic
1015784505 6:136907766-136907788 AAATATTTTAATAAAGTGGAGGG + Intronic
1015861825 6:137689467-137689489 TTATATGTGCAAAATTTGGAAGG + Intergenic
1016089365 6:139957071-139957093 TTCTATATTCAGAAATTGGATGG + Intergenic
1016328572 6:142931465-142931487 TTATATTGCCAAAAAGTAGGAGG + Intronic
1016477960 6:144449152-144449174 TTTTATTGTCAGAAAGTGCAGGG + Intronic
1016596711 6:145811453-145811475 TAAGATTTTAAAACAGTGGAAGG - Intronic
1016673508 6:146736135-146736157 TTTTCTTTACAAAAATTGGATGG + Intronic
1016831515 6:148438403-148438425 TTATATATTCCAAATGTGAATGG - Intronic
1017230875 6:152072365-152072387 TGATATTTTAAGAAAGAGGAGGG + Intronic
1017936470 6:159010051-159010073 TTTTATTTTTCAAAACTGGAAGG - Intergenic
1018311949 6:162518995-162519017 TTATATTTTCCTAAAGTGCTAGG - Intronic
1018834642 6:167473748-167473770 TTTTATTTTCACTAAGTTGAGGG + Intergenic
1019401186 7:855021-855043 TTTTATTTTAAAAAAGCGTAAGG - Intronic
1020344958 7:7152616-7152638 TTATACTTTTAAATAGTTGAGGG - Intergenic
1020824750 7:13012801-13012823 TGATCTTTTCAACAAGTGGAGGG - Intergenic
1020896807 7:13950690-13950712 TCATCTTTTCAAAAAGTAGTGGG + Intronic
1021066049 7:16173991-16174013 TTAAAATTTCCAAATGTGGAAGG + Intronic
1021148496 7:17119758-17119780 TAAAATGTTCAAAAAGTTGAAGG + Intergenic
1021394616 7:20131963-20131985 TAATATTTTCAGAACGGGGATGG + Intergenic
1021535286 7:21697113-21697135 TTATATTTACAAAAACAGGTAGG + Intronic
1021554039 7:21901681-21901703 TTATATTTTGAAAGAGTTTAAGG - Exonic
1022002173 7:26236357-26236379 TAATTTTTTAAAAAAGTGCATGG + Intergenic
1022252790 7:28625483-28625505 TTATATAGTCAAAAAGAAGAGGG + Intronic
1022332640 7:29395005-29395027 TTATTTTTTTAAAAAATGAAGGG + Intronic
1022784088 7:33618683-33618705 TTACATTTTAAAAAAATAGATGG - Intergenic
1023174612 7:37423827-37423849 TTATTTTTTAAAAAAGAGAAAGG - Intronic
1023799237 7:43819079-43819101 TGATATTTGCAGAAAGAGGAGGG + Intergenic
1024161990 7:46685581-46685603 TTAAATTTTAAAATAGTAGAAGG - Intronic
1024386585 7:48758825-48758847 TTATATTTTCAGACAGAGGCTGG + Intergenic
1024701955 7:51913339-51913361 ATATATTTTAAATAAATGGATGG - Intergenic
1024706298 7:51964189-51964211 AAATAGTTTTAAAAAGTGGATGG - Intergenic
1025617273 7:63131713-63131735 TTAAACGTTAAAAAAGTGGAGGG + Intergenic
1026403032 7:70035551-70035573 TTATATTTTCAAAAGTTGTATGG + Intronic
1026938292 7:74271608-74271630 CTATATTTTAAAAAATTGGCTGG + Intergenic
1027335839 7:77149344-77149366 TTCTATTTTTAAAAAGCTGACGG - Intronic
1027630015 7:80592691-80592713 TAATATTTTTAAGAACTGGAGGG + Intronic
1028146434 7:87325050-87325072 ATATATTTTCCAAAATTGTATGG - Intergenic
1028207747 7:88035560-88035582 GTATTTTTTTAAAAATTGGATGG + Intronic
1028283657 7:88967097-88967119 TTATACTATCAAAAACTGAAAGG - Intronic
1028292398 7:89081697-89081719 TTAGATTTTAAAATAGTGAAGGG - Intronic
1028311727 7:89346524-89346546 TTATATTTGCAAAAAGCTGGGGG - Intergenic
1028315487 7:89396884-89396906 ACATTTTTTCAAAAAGAGGATGG + Intergenic
1028353464 7:89878617-89878639 TTCTCTTTTCATCAAGTGGAAGG + Intergenic
1028686495 7:93594890-93594912 TTCTCTTTTCAAAAAGTTGATGG + Intronic
1028892532 7:96003841-96003863 CTATATTTTTAAAAAATAGATGG - Intronic
1029858422 7:103542933-103542955 TTATATTTTTAAAAGGAGTATGG + Intronic
1029875967 7:103752114-103752136 TTTTGTTTTCATAAAGTGTATGG - Intronic
1030144341 7:106338169-106338191 ATATATTTTCCAAAATTGTATGG + Intergenic
1030239818 7:107309948-107309970 TTATATTTTTAAAAAACTGAAGG - Intronic
1030908579 7:115217227-115217249 TTATATATTCCCAGAGTGGAAGG + Intergenic
1031047179 7:116904828-116904850 TTATATTTTCAAGAAATATATGG + Intronic
1031170587 7:118287714-118287736 TAATATATTCAAAATGTAGAAGG + Intergenic
1031263494 7:119552892-119552914 GTATATTTTCAAAAACTGAGGGG - Intergenic
1031269406 7:119627650-119627672 TTATATTTTTAAAAATTTGCTGG + Intergenic
1031483083 7:122301224-122301246 TTAGATTTTAAAAAGGCGGAGGG + Intergenic
1034038788 7:147854529-147854551 TTATATTTTCTAAATGTTGTGGG - Intronic
1034834287 7:154337330-154337352 TTATGTTTTCAAAAAGAATAGGG - Intronic
1035138596 7:156733393-156733415 CTATATTTTCACAAAGAGGGAGG + Intronic
1035903355 8:3481400-3481422 TAATAATTTCAAAAAGTTGAAGG + Intronic
1036521035 8:9491864-9491886 TTTGATTTTGAAAAAGAGGATGG - Intergenic
1037175168 8:15938604-15938626 TTATATTTTGGTACAGTGGAAGG - Intergenic
1037433307 8:18837149-18837171 ATATATTCCCAAAAAGTGGATGG + Intronic
1037612554 8:20488581-20488603 TTCTCTTTTCACAAAGTGGAGGG + Intergenic
1038388961 8:27176855-27176877 TTATATTTTTAAAAAGGAAAAGG + Intergenic
1039035414 8:33354076-33354098 TCAAATTTTCAAAAAGTCGGCGG - Intergenic
1039772916 8:40706494-40706516 TCATCTTTTCAGAAAGTGGTGGG + Intronic
1039811763 8:41055238-41055260 CTATATTTGCAAAAAATGAAAGG - Intergenic
1040526613 8:48230943-48230965 ATATATTTTCTAAAATTGTATGG + Intergenic
1040894976 8:52356688-52356710 AAATATTTTCAAAGAGTTGAAGG + Intronic
1041212319 8:55564747-55564769 TTATATTCTCACATGGTGGAAGG - Intergenic
1041646964 8:60262999-60263021 TTATAATTTCTAAAAGGTGAGGG + Intronic
1042132484 8:65601372-65601394 TTTTATTTTTAAAAAATGGGAGG - Intergenic
1042147278 8:65743284-65743306 CTGTATTTTCAAAAAGGAGAAGG + Intronic
1042204756 8:66317788-66317810 TTATTTTTTAAAAAAGGGGGGGG + Intergenic
1042445226 8:68876406-68876428 ATATATTTTCAAAAAGAGACCGG - Intergenic
1042719372 8:71810648-71810670 TTATAATTTAAAAAAGTCTATGG + Intergenic
1042815681 8:72875494-72875516 TTATATTAACACCAAGTGGAAGG + Intronic
1043091469 8:75909756-75909778 TTAAAATCTCAAAAAGAGGAAGG + Intergenic
1043267154 8:78280410-78280432 TTTTATTTTACAAAGGTGGAGGG - Intergenic
1043489159 8:80730688-80730710 TTATAGCTTTAAAAAATGGAAGG - Intronic
1043746046 8:83874751-83874773 TTATATTTAGAAAATGTGGCTGG - Intergenic
1044110805 8:88270904-88270926 TGATATTTTCAAATAGTTGCTGG - Intronic
1044130272 8:88514258-88514280 TTATATTTTCTAAATTTGGGTGG - Intergenic
1044156222 8:88850672-88850694 ATATATTTTCAAAATGTTTATGG + Intergenic
1044264987 8:90171403-90171425 TTTTATCTTGAAAAAATGGAAGG - Intergenic
1044441211 8:92226720-92226742 CTATATTTTCAAAACATGAATGG + Intergenic
1044535197 8:93349837-93349859 CTGTATTTTCAAACAGCGGAAGG + Intergenic
1044825865 8:96196321-96196343 ATTTATTTTCAAAAAAAGGAAGG + Intergenic
1044996004 8:97838821-97838843 TTACCTTTTCACACAGTGGAAGG + Intronic
1045368345 8:101496461-101496483 ATATTCTTTCAAAAAGTGAATGG - Intronic
1045730686 8:105236778-105236800 TTATATTTTAAAAGTGGGGAGGG - Intronic
1045940939 8:107737383-107737405 TGGTAATTTCCAAAAGTGGACGG - Intergenic
1046864712 8:119134600-119134622 TTATATTTTTAACAAATGAAGGG - Intergenic
1047281175 8:123447116-123447138 TTATATATTTAAAAAGTACAAGG - Intronic
1048112300 8:131481775-131481797 TTAAAATTTTAAAAAGTGAATGG + Intergenic
1048436251 8:134421022-134421044 TAATCTTTTCAGACAGTGGAGGG + Intergenic
1048556870 8:135486919-135486941 TTTTATTTTCTTAAAGAGGATGG + Intronic
1050173795 9:2849703-2849725 CTATAGTTTTAAAAAGTGGGAGG - Intergenic
1050272582 9:3961740-3961762 TATTAATTTCAAAAAGTTGAGGG + Intronic
1050610317 9:7345215-7345237 TTATATTGTTAAAGGGTGGAAGG + Intergenic
1050623494 9:7478854-7478876 TTATTTATTCAAAAGGCGGAAGG - Intergenic
1051219666 9:14834772-14834794 ATATATGTTCAAAAATTGTATGG + Intronic
1051316881 9:15846456-15846478 TTATTTTTTCAAATACTGCAAGG - Intronic
1051412433 9:16804549-16804571 TTTTATTTTGAAAAATTGAAAGG - Intronic
1051846910 9:21462322-21462344 TTCTATTATAAAAAAGTAGAGGG + Intergenic
1051880923 9:21839180-21839202 TTTTTTTTTAAAAAAGTGGCAGG + Intronic
1051897401 9:22002525-22002547 TAATATTTTCAAAAAAGGGAGGG + Intronic
1052040197 9:23729579-23729601 GTATATTATCAAAATGTGAAGGG - Intronic
1052326232 9:27219200-27219222 GCATATTTTAAAAAACTGGAAGG + Intronic
1052361254 9:27562121-27562143 TTATAATTCCTAAAAGTGGGAGG - Intronic
1052800872 9:32966870-32966892 TTTTATTTTTAAAAAGTGATAGG - Intergenic
1053660529 9:40273434-40273456 GTTTATTTACAAAAAGTGTATGG + Intronic
1053709366 9:40789937-40789959 TTAAATATTCTAAAAGTGGTCGG - Intergenic
1053910904 9:42902778-42902800 GTTTATTTACAAAAAGTGTATGG + Intergenic
1054361535 9:64126352-64126374 GTTTATTTACAAAAAGTGTATGG + Intergenic
1054372649 9:64419652-64419674 GTTTATTTACAAAAAGTGTATGG + Intergenic
1054419274 9:64910740-64910762 TTAAATATTCTAAAAGTGGTCGG - Intergenic
1054524082 9:66102850-66102872 GTTTATTTACAAAAAGTGTATGG - Intergenic
1054680276 9:67909427-67909449 GTTTATTTACAAAAAGTGTATGG + Intergenic
1054881987 9:70153777-70153799 TTATATTTTTAAAAACTGGTTGG - Intronic
1054942942 9:70763510-70763532 TTATATTTAGAAAAAGAGGATGG + Intronic
1054963646 9:70997520-70997542 TCATATTTTGAAAAGGTGAAAGG - Intronic
1055209844 9:73778556-73778578 TTTTATTTGCAAAAAGTCAATGG - Intergenic
1055360259 9:75482175-75482197 ATATATTTTCATAAAGTGGATGG - Intergenic
1055560990 9:77521555-77521577 TTCCATTCTCAGAAAGTGGAAGG - Intronic
1055569705 9:77604084-77604106 TTATATTTACAAAAATTTGTGGG - Intronic
1055691845 9:78840654-78840676 TTTCATTTTCATTAAGTGGATGG - Intergenic
1055764892 9:79652125-79652147 ATATATTTTTAAAAGGGGGAAGG - Intronic
1055891079 9:81123825-81123847 TTGCATTTTCAAAAAGTTCATGG - Intergenic
1056235886 9:84593890-84593912 TTATATTTTATAAAAGTTGAAGG - Intergenic
1057983844 9:99689332-99689354 TTATATTTTCATGAAGTTTATGG - Intergenic
1059233870 9:112745924-112745946 TTATAGTTTAGAAAAATGGAAGG + Intergenic
1060245881 9:121945950-121945972 TTATATTTTCGAAAGATGGAAGG - Intronic
1060292976 9:122321172-122321194 GTGTATTTTTAAAAACTGGAAGG - Intronic
1062251038 9:135593706-135593728 TTAAATTTTCAAAATATAGATGG + Intergenic
1185979646 X:4762923-4762945 TTATATTTTTAAAAAATTTAAGG - Intergenic
1186822868 X:13309266-13309288 TTTCATTTTCAAAAAGTAAAGGG + Intergenic
1187003919 X:15212877-15212899 ACATATTTTCAAAAACAGGAGGG - Intergenic
1187019872 X:15369831-15369853 TAAAATTTTTAAAAAGAGGAAGG + Intronic
1187020134 X:15373048-15373070 TTTTATTTTGAAAAATTGGTTGG - Intronic
1187537189 X:20152747-20152769 TTATATGTTCACAAAATGGAAGG - Exonic
1188291824 X:28398998-28399020 TTATAATTTCATAATGTGGATGG + Intergenic
1188461636 X:30433813-30433835 TTATACTTTCAAATAGTTGATGG + Intergenic
1188545086 X:31296384-31296406 TTCTATTTTCAAAAAGCTAATGG + Intronic
1188766316 X:34096275-34096297 TTATATTTTCCAAAACAGCAGGG + Intergenic
1188994629 X:36868222-36868244 ATATAATTTCAAACAGAGGAGGG - Intergenic
1189001508 X:36952479-36952501 ATATATGTTCAAAAATTGTATGG + Intergenic
1190447563 X:50544105-50544127 GTAGATTTTTAAAAAGTTGAGGG - Intergenic
1190722985 X:53166105-53166127 ATATATGTTCAAAAATTGTATGG + Intergenic
1190749697 X:53351045-53351067 TAATATTTGCAAAAGGTGTAAGG - Intergenic
1191091475 X:56627397-56627419 CTATATTTTCAATCAGTGCATGG - Intergenic
1191226289 X:58048026-58048048 TAAGGGTTTCAAAAAGTGGAGGG - Intergenic
1191653677 X:63571854-63571876 AAATATTTTCAAAATGTTGAGGG + Intergenic
1192375142 X:70551852-70551874 TTATATTTTCAAATCATGGTGGG - Intronic
1193179998 X:78443090-78443112 TTATTTTTTTAAAAGGTGGGAGG - Intergenic
1193365459 X:80626802-80626824 TAATATTTTCAGACAGTGGTTGG - Intergenic
1193584202 X:83300583-83300605 TTATATTTTTTAAAAGTAGGAGG + Intergenic
1193654580 X:84184119-84184141 TTATATTTAGAAACAGTGGAAGG - Intronic
1193667536 X:84340544-84340566 ATACATTTTCATAAACTGGAAGG + Intronic
1193866416 X:86737113-86737135 GTCTATTTTTAAAAAGTGAAAGG + Intronic
1193889728 X:87030341-87030363 TTTCATATTCAAAATGTGGAAGG + Intergenic
1194082357 X:89484898-89484920 AAACATTTTCAAAAAGTGGGTGG - Intergenic
1194314884 X:92365220-92365242 TTCTTTTTTCAATAAGTAGAAGG + Intronic
1194548276 X:95265455-95265477 TAATATTTTCAAAAATGGGGTGG - Intergenic
1194678095 X:96817694-96817716 TTATATTTTCACATGGTAGAAGG + Intronic
1194710560 X:97231597-97231619 TAATATTTTCAAAATGTGAATGG - Intronic
1194735287 X:97505691-97505713 TTATCTTTTCAGTAAGTTGAGGG + Intronic
1194951545 X:100132798-100132820 TCATATTTTCAAAAAGGTCAAGG + Intergenic
1195101067 X:101554097-101554119 TTATATTCTCAAATAGGGTAAGG - Exonic
1195158545 X:102147929-102147951 TGACATTTTCAGAAAGTTGAAGG - Intergenic
1195268050 X:103202952-103202974 TGATATTTTTTAAAACTGGAAGG + Intergenic
1195741476 X:108069004-108069026 TTAAATGTTCAAAAACTGGAGGG + Intronic
1195791292 X:108590532-108590554 TTTCATTTTCAAAAACTGGTTGG - Intronic
1196331497 X:114475436-114475458 TAATATTTTTAAAAATTGGCTGG - Intergenic
1196432661 X:115643601-115643623 TTATATCTACAAGAAGTAGATGG + Intronic
1196769031 X:119274390-119274412 TTATATCTTTTGAAAGTGGAAGG + Intergenic
1197691518 X:129505772-129505794 TTTTATTTTCATTAAGTTGAAGG - Intronic
1197698132 X:129572983-129573005 TTTTATTTTCACAACCTGGAAGG - Intronic
1198182414 X:134222727-134222749 TTCTTTTGTCAAAAATTGGATGG - Intergenic
1198335900 X:135666440-135666462 GAATATTTTCAAAAATTGCACGG + Intergenic
1198736746 X:139793870-139793892 TGATATTTTTAAAAACTTGAGGG + Intronic
1198896434 X:141460707-141460729 TTATATTTTGTTTAAGTGGAGGG + Intergenic
1199119519 X:144035052-144035074 TCATATTTTCACATGGTGGAAGG - Intergenic
1199135645 X:144248102-144248124 TTATATTTGAAAAAATTGAAAGG + Intergenic
1199495301 X:148446352-148446374 TTCTAGTTTTAAAAAATGGATGG - Intergenic
1199762345 X:150914758-150914780 GTATATTTTAAAAGAGTGAATGG + Intergenic
1200102702 X:153695964-153695986 GTATATTTCTAAAAAGAGGAAGG + Exonic
1200622935 Y:5476750-5476772 TTCTTTTTTCAATAAGTAGAAGG + Intronic
1200968381 Y:9122745-9122767 TTATCTTTTCAGAAACTGTATGG - Intergenic
1201687385 Y:16721970-16721992 TTATTTTTAAAAAAAGGGGAGGG - Intergenic
1202142379 Y:21739515-21739537 TTATCTTTTCAAAAACTTTATGG + Intergenic
1202144486 Y:21764287-21764309 TTATCTTTTCAAAAACTTTATGG - Intergenic