ID: 1012519422

View in Genome Browser
Species Human (GRCh38)
Location 6:100103214-100103236
Sequence CAGACTAAAGAGCCTGTGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012519422_1012519423 10 Left 1012519422 6:100103214-100103236 CCAATCACAGGCTCTTTAGTCTG No data
Right 1012519423 6:100103247-100103269 CAGACACTTCTCTGCCCTCTTGG No data
1012519422_1012519426 17 Left 1012519422 6:100103214-100103236 CCAATCACAGGCTCTTTAGTCTG No data
Right 1012519426 6:100103254-100103276 TTCTCTGCCCTCTTGGGGACCGG No data
1012519422_1012519425 12 Left 1012519422 6:100103214-100103236 CCAATCACAGGCTCTTTAGTCTG No data
Right 1012519425 6:100103249-100103271 GACACTTCTCTGCCCTCTTGGGG No data
1012519422_1012519427 18 Left 1012519422 6:100103214-100103236 CCAATCACAGGCTCTTTAGTCTG No data
Right 1012519427 6:100103255-100103277 TCTCTGCCCTCTTGGGGACCGGG No data
1012519422_1012519424 11 Left 1012519422 6:100103214-100103236 CCAATCACAGGCTCTTTAGTCTG No data
Right 1012519424 6:100103248-100103270 AGACACTTCTCTGCCCTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012519422 Original CRISPR CAGACTAAAGAGCCTGTGAT TGG (reversed) Intergenic
No off target data available for this crispr