ID: 1012519425

View in Genome Browser
Species Human (GRCh38)
Location 6:100103249-100103271
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012519422_1012519425 12 Left 1012519422 6:100103214-100103236 CCAATCACAGGCTCTTTAGTCTG No data
Right 1012519425 6:100103249-100103271 GACACTTCTCTGCCCTCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012519425 Original CRISPR GACACTTCTCTGCCCTCTTG GGG Intergenic
No off target data available for this crispr