ID: 1012519665

View in Genome Browser
Species Human (GRCh38)
Location 6:100106102-100106124
Sequence GAAAGTCAACATCATCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012519665_1012519672 11 Left 1012519665 6:100106102-100106124 CCTGGGTGATGATGTTGACTTTC No data
Right 1012519672 6:100106136-100106158 GCACACCACGTGGGGCCACATGG No data
1012519665_1012519673 12 Left 1012519665 6:100106102-100106124 CCTGGGTGATGATGTTGACTTTC No data
Right 1012519673 6:100106137-100106159 CACACCACGTGGGGCCACATGGG No data
1012519665_1012519677 25 Left 1012519665 6:100106102-100106124 CCTGGGTGATGATGTTGACTTTC No data
Right 1012519677 6:100106150-100106172 GCCACATGGGGAAGCAACCAGGG No data
1012519665_1012519668 1 Left 1012519665 6:100106102-100106124 CCTGGGTGATGATGTTGACTTTC No data
Right 1012519668 6:100106126-100106148 AGGAGTCCAGGCACACCACGTGG No data
1012519665_1012519674 13 Left 1012519665 6:100106102-100106124 CCTGGGTGATGATGTTGACTTTC No data
Right 1012519674 6:100106138-100106160 ACACCACGTGGGGCCACATGGGG No data
1012519665_1012519676 24 Left 1012519665 6:100106102-100106124 CCTGGGTGATGATGTTGACTTTC No data
Right 1012519676 6:100106149-100106171 GGCCACATGGGGAAGCAACCAGG No data
1012519665_1012519670 3 Left 1012519665 6:100106102-100106124 CCTGGGTGATGATGTTGACTTTC No data
Right 1012519670 6:100106128-100106150 GAGTCCAGGCACACCACGTGGGG No data
1012519665_1012519669 2 Left 1012519665 6:100106102-100106124 CCTGGGTGATGATGTTGACTTTC No data
Right 1012519669 6:100106127-100106149 GGAGTCCAGGCACACCACGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012519665 Original CRISPR GAAAGTCAACATCATCACCC AGG (reversed) Intergenic
No off target data available for this crispr