ID: 1012519671

View in Genome Browser
Species Human (GRCh38)
Location 6:100106132-100106154
Sequence GTGGCCCCACGTGGTGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012519671_1012519681 6 Left 1012519671 6:100106132-100106154 CCAGGCACACCACGTGGGGCCAC No data
Right 1012519681 6:100106161-100106183 AAGCAACCAGGGTTAGTCAGGGG No data
1012519671_1012519685 25 Left 1012519671 6:100106132-100106154 CCAGGCACACCACGTGGGGCCAC No data
Right 1012519685 6:100106180-100106202 GGGGACAGAGAAAGAGTGAGGGG No data
1012519671_1012519683 23 Left 1012519671 6:100106132-100106154 CCAGGCACACCACGTGGGGCCAC No data
Right 1012519683 6:100106178-100106200 CAGGGGACAGAGAAAGAGTGAGG No data
1012519671_1012519676 -6 Left 1012519671 6:100106132-100106154 CCAGGCACACCACGTGGGGCCAC No data
Right 1012519676 6:100106149-100106171 GGCCACATGGGGAAGCAACCAGG No data
1012519671_1012519677 -5 Left 1012519671 6:100106132-100106154 CCAGGCACACCACGTGGGGCCAC No data
Right 1012519677 6:100106150-100106172 GCCACATGGGGAAGCAACCAGGG No data
1012519671_1012519680 5 Left 1012519671 6:100106132-100106154 CCAGGCACACCACGTGGGGCCAC No data
Right 1012519680 6:100106160-100106182 GAAGCAACCAGGGTTAGTCAGGG No data
1012519671_1012519684 24 Left 1012519671 6:100106132-100106154 CCAGGCACACCACGTGGGGCCAC No data
Right 1012519684 6:100106179-100106201 AGGGGACAGAGAAAGAGTGAGGG No data
1012519671_1012519679 4 Left 1012519671 6:100106132-100106154 CCAGGCACACCACGTGGGGCCAC No data
Right 1012519679 6:100106159-100106181 GGAAGCAACCAGGGTTAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012519671 Original CRISPR GTGGCCCCACGTGGTGTGCC TGG (reversed) Intergenic
No off target data available for this crispr