ID: 1012519676

View in Genome Browser
Species Human (GRCh38)
Location 6:100106149-100106171
Sequence GGCCACATGGGGAAGCAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012519665_1012519676 24 Left 1012519665 6:100106102-100106124 CCTGGGTGATGATGTTGACTTTC No data
Right 1012519676 6:100106149-100106171 GGCCACATGGGGAAGCAACCAGG No data
1012519671_1012519676 -6 Left 1012519671 6:100106132-100106154 CCAGGCACACCACGTGGGGCCAC No data
Right 1012519676 6:100106149-100106171 GGCCACATGGGGAAGCAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012519676 Original CRISPR GGCCACATGGGGAAGCAACC AGG Intergenic
No off target data available for this crispr