ID: 1012520878

View in Genome Browser
Species Human (GRCh38)
Location 6:100119871-100119893
Sequence TGTGGTCCACAGTAAAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012520875_1012520878 3 Left 1012520875 6:100119845-100119867 CCTGGTACTGCACAGGGATTTAC No data
Right 1012520878 6:100119871-100119893 TGTGGTCCACAGTAAAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012520878 Original CRISPR TGTGGTCCACAGTAAAAGGC AGG Intergenic
No off target data available for this crispr