ID: 1012522075

View in Genome Browser
Species Human (GRCh38)
Location 6:100134104-100134126
Sequence CTGTAGACTTACTTGGTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012522075_1012522079 22 Left 1012522075 6:100134104-100134126 CCAAGCACCAAGTAAGTCTACAG No data
Right 1012522079 6:100134149-100134171 AGAATGACAAAATGAAGAAATGG No data
1012522075_1012522077 -6 Left 1012522075 6:100134104-100134126 CCAAGCACCAAGTAAGTCTACAG No data
Right 1012522077 6:100134121-100134143 CTACAGCAATTGCCACTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012522075 Original CRISPR CTGTAGACTTACTTGGTGCT TGG (reversed) Intergenic
No off target data available for this crispr