ID: 1012522939

View in Genome Browser
Species Human (GRCh38)
Location 6:100142646-100142668
Sequence AGTACACCTTTGTTATTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012522939_1012522943 11 Left 1012522939 6:100142646-100142668 CCATAAAATAACAAAGGTGTACT No data
Right 1012522943 6:100142680-100142702 TCATATACACTACAGATGGGAGG No data
1012522939_1012522946 20 Left 1012522939 6:100142646-100142668 CCATAAAATAACAAAGGTGTACT No data
Right 1012522946 6:100142689-100142711 CTACAGATGGGAGGGTAATTGGG No data
1012522939_1012522942 8 Left 1012522939 6:100142646-100142668 CCATAAAATAACAAAGGTGTACT No data
Right 1012522942 6:100142677-100142699 CATTCATATACACTACAGATGGG No data
1012522939_1012522941 7 Left 1012522939 6:100142646-100142668 CCATAAAATAACAAAGGTGTACT No data
Right 1012522941 6:100142676-100142698 CCATTCATATACACTACAGATGG No data
1012522939_1012522944 12 Left 1012522939 6:100142646-100142668 CCATAAAATAACAAAGGTGTACT No data
Right 1012522944 6:100142681-100142703 CATATACACTACAGATGGGAGGG No data
1012522939_1012522945 19 Left 1012522939 6:100142646-100142668 CCATAAAATAACAAAGGTGTACT No data
Right 1012522945 6:100142688-100142710 ACTACAGATGGGAGGGTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012522939 Original CRISPR AGTACACCTTTGTTATTTTA TGG (reversed) Intergenic
No off target data available for this crispr