ID: 1012522943

View in Genome Browser
Species Human (GRCh38)
Location 6:100142680-100142702
Sequence TCATATACACTACAGATGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012522939_1012522943 11 Left 1012522939 6:100142646-100142668 CCATAAAATAACAAAGGTGTACT No data
Right 1012522943 6:100142680-100142702 TCATATACACTACAGATGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012522943 Original CRISPR TCATATACACTACAGATGGG AGG Intergenic
No off target data available for this crispr