ID: 1012523358

View in Genome Browser
Species Human (GRCh38)
Location 6:100147276-100147298
Sequence GAGTTTTAGCATGTAATCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012523356_1012523358 16 Left 1012523356 6:100147237-100147259 CCACTTTCTTTATTTTACAAAAT No data
Right 1012523358 6:100147276-100147298 GAGTTTTAGCATGTAATCCCTGG No data
1012523357_1012523358 -9 Left 1012523357 6:100147262-100147284 CCAAGAAGATAGTTGAGTTTTAG No data
Right 1012523358 6:100147276-100147298 GAGTTTTAGCATGTAATCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012523358 Original CRISPR GAGTTTTAGCATGTAATCCC TGG Intergenic
No off target data available for this crispr