ID: 1012526342

View in Genome Browser
Species Human (GRCh38)
Location 6:100182473-100182495
Sequence TGGAGCAAATGCAGCTCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012526334_1012526342 19 Left 1012526334 6:100182431-100182453 CCTTCAGGTTGGACCCCAGGCTT No data
Right 1012526342 6:100182473-100182495 TGGAGCAAATGCAGCTCAGCTGG No data
1012526332_1012526342 22 Left 1012526332 6:100182428-100182450 CCTCCTTCAGGTTGGACCCCAGG No data
Right 1012526342 6:100182473-100182495 TGGAGCAAATGCAGCTCAGCTGG No data
1012526336_1012526342 5 Left 1012526336 6:100182445-100182467 CCCAGGCTTCTCCTACTTCCTGT No data
Right 1012526342 6:100182473-100182495 TGGAGCAAATGCAGCTCAGCTGG No data
1012526337_1012526342 4 Left 1012526337 6:100182446-100182468 CCAGGCTTCTCCTACTTCCTGTC No data
Right 1012526342 6:100182473-100182495 TGGAGCAAATGCAGCTCAGCTGG No data
1012526339_1012526342 -6 Left 1012526339 6:100182456-100182478 CCTACTTCCTGTCCAAGTGGAGC No data
Right 1012526342 6:100182473-100182495 TGGAGCAAATGCAGCTCAGCTGG No data
1012526335_1012526342 6 Left 1012526335 6:100182444-100182466 CCCCAGGCTTCTCCTACTTCCTG No data
Right 1012526342 6:100182473-100182495 TGGAGCAAATGCAGCTCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012526342 Original CRISPR TGGAGCAAATGCAGCTCAGC TGG Intergenic
No off target data available for this crispr