ID: 1012527010

View in Genome Browser
Species Human (GRCh38)
Location 6:100189984-100190006
Sequence CCATAAGTATGATGGAAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012527010_1012527015 -6 Left 1012527010 6:100189984-100190006 CCAATCTTCCATCATACTTATGG No data
Right 1012527015 6:100190001-100190023 TTATGGGGCAGAAATGCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012527010 Original CRISPR CCATAAGTATGATGGAAGAT TGG (reversed) Intergenic
No off target data available for this crispr