ID: 1012546798

View in Genome Browser
Species Human (GRCh38)
Location 6:100428997-100429019
Sequence CTGTGGATAAGGGGGGACTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 2, 1: 1, 2: 10, 3: 30, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012546792_1012546798 -8 Left 1012546792 6:100428982-100429004 CCACAGAAAGCAAAACTGTGGAT 0: 15
1: 21
2: 81
3: 188
4: 502
Right 1012546798 6:100428997-100429019 CTGTGGATAAGGGGGGACTATGG 0: 2
1: 1
2: 10
3: 30
4: 137
1012546790_1012546798 8 Left 1012546790 6:100428966-100428988 CCTCATATTACTGAAACCACAGA 0: 1
1: 0
2: 11
3: 70
4: 390
Right 1012546798 6:100428997-100429019 CTGTGGATAAGGGGGGACTATGG 0: 2
1: 1
2: 10
3: 30
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012546798 Original CRISPR CTGTGGATAAGGGGGGACTA TGG Intronic
900809617 1:4791878-4791900 CTGAGGAGGAGGGGGGACAATGG - Exonic
900959284 1:5909068-5909090 CTGTGCTTAAGGGGGGACAGAGG + Intronic
902307054 1:15549418-15549440 GGGTGGATCAGGGGAGACTACGG - Intronic
903370146 1:22830053-22830075 CTGGTGGGAAGGGGGGACTAGGG + Intronic
905488207 1:38322623-38322645 CTGGGGATCAGGGGGTACTGGGG + Intergenic
905805474 1:40873954-40873976 CTGTGGGTAGGGAGGGACAACGG + Intergenic
905975314 1:42170009-42170031 CTGTGGGAATGGGGGGACTGAGG - Intergenic
907871396 1:58446764-58446786 CAGTGGATAAGAGAGAACTAAGG + Intronic
908863540 1:68519246-68519268 CTGAGAATAAGGGGGAACTATGG - Intergenic
912517718 1:110226540-110226562 CTGTGTTTAAGGGAGGCCTAGGG - Intronic
912523583 1:110264479-110264501 CCTCAGATAAGGGGGGACTAAGG - Intronic
915172175 1:153985846-153985868 TTGTGGATTTGGGGAGACTAAGG + Intronic
916436572 1:164783142-164783164 CTCTGGCTCAGGGGAGACTAGGG + Intronic
919277492 1:195439822-195439844 CTGTGGATAAAGGAGGCCAAAGG - Intergenic
919939805 1:202278436-202278458 CTGAGGACAAGGAGGGACAAGGG + Intronic
922660225 1:227423592-227423614 CCGTCAATAAGGGGGGACTATGG + Intergenic
1063251102 10:4275951-4275973 CTGTGGATAAGGCAGGACTATGG + Intergenic
1063694994 10:8326294-8326316 CTGTGGAGAAGCTGGGAGTATGG + Intergenic
1064154747 10:12894642-12894664 GTGTGGATTATGGGGTACTAGGG - Intergenic
1064281229 10:13953353-13953375 CTCTAGATAATGGGGGACTATGG - Intronic
1065806993 10:29403164-29403186 CTGTGGAAAAGGCAGAACTATGG + Intergenic
1065943596 10:30587279-30587301 CTCAGGAGAAGGGGGGACTGGGG + Intergenic
1067744173 10:48922674-48922696 CTGTGGGTAAGCGAGGACTGTGG + Intronic
1069003548 10:63292689-63292711 CTGTTAATAAAGAGGGACTATGG - Intronic
1069307569 10:66990238-66990260 CTGTGGATATTGGGAGACAATGG - Intronic
1070267005 10:74913228-74913250 AGGTGGATAAGGGGGGACCATGG - Intronic
1070553710 10:77512277-77512299 CTATGGATAAGGGGGGACTGTGG - Intronic
1076827295 10:132975454-132975476 CTGAGGATAAGGAGGGGGTAAGG - Intergenic
1078468491 11:11568497-11568519 CTCTGGTTAAGGGGGGAAAAAGG + Intronic
1078893727 11:15579888-15579910 ATGTGGAAAAGCTGGGACTATGG + Intergenic
1080703637 11:34667678-34667700 CTGTGAATATGGGGGGACCATGG - Intergenic
1083281188 11:61628224-61628246 CTCTGGACAAGGTGGGACTGGGG - Intergenic
1087551368 11:99654469-99654491 CTGTGGAACAGGGGGTAGTATGG + Intronic
1087632153 11:100662520-100662542 CCGTGGATAAGGAGGGACTACGG - Intergenic
1088061142 11:105652722-105652744 CTATAGATAAGGGGATACTATGG - Intronic
1090900434 11:131026159-131026181 CTGGGGATAAGAGGGGAAAAGGG + Intergenic
1091695147 12:2623353-2623375 CTGTGGACAATGGGGAACCATGG - Intronic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1093207653 12:16269750-16269772 CTGTTGCTAAGGGGTTACTAGGG - Intronic
1094001075 12:25694879-25694901 CAGTGAATAAGGGGGGACTATGG + Intergenic
1094441924 12:30487064-30487086 CTGGGGATAAGGGAGGAGCAGGG + Intergenic
1098583349 12:72127951-72127973 CTGAGAATCTGGGGGGACTAAGG + Intronic
1100623364 12:96303852-96303874 CTGTGGATAAGGGGGACCTCTGG - Intronic
1100662695 12:96717320-96717342 CTGAGGATGAGGGAGGGCTAGGG - Intronic
1104698994 12:130886901-130886923 CTGTGCATATGTGGGGAGTAGGG + Intergenic
1104759229 12:131287114-131287136 CTGTGGATGATGGGGGCCCAGGG - Intergenic
1104821382 12:131679382-131679404 CTGTGGATGATGGGGGCCCAGGG + Intergenic
1105208066 13:18239485-18239507 CTGTGGAGAAGGGGGGATTTCGG + Intergenic
1106522467 13:30510026-30510048 CTGTGGATTTGGGAGGGCTATGG - Intronic
1108742571 13:53353767-53353789 CCATGGATAAGGAGTGACTATGG + Intergenic
1108891459 13:55265875-55265897 CTATGGATAAGTGGGGACTACGG - Intergenic
1122376251 14:101261074-101261096 CTGTGGATAAAGGGGGATGATGG + Intergenic
1122427682 14:101621209-101621231 ATGGGGAGAAGGGGGAACTAGGG - Intergenic
1122938673 14:104971632-104971654 CTCTGGATAGTGGGGGACTTGGG - Intronic
1125365194 15:38905980-38906002 GAGTGGATAAGTGGGGATTAAGG - Intergenic
1126901455 15:53318850-53318872 CTATGGGGAAGGGGGGACCAAGG + Intergenic
1126988761 15:54345785-54345807 CTGTGGATAATGGGAGAGTCTGG - Intronic
1127995984 15:64153334-64153356 CTGGGGGTAAGGGGGGCCGATGG + Exonic
1128671639 15:69578271-69578293 CTGGGGAGAAGGCGGGACTTTGG + Intergenic
1129756691 15:78103160-78103182 CTGTGGGTCAGGGGAGACCAGGG + Intronic
1133098132 16:3461444-3461466 CTGCTGACAAGGTGGGACTAGGG - Intronic
1133966994 16:10538668-10538690 CAGTGGAGAAGGGAGGCCTAGGG + Intronic
1136922361 16:34343755-34343777 CTGAGGATGAGGTGGGACTGTGG - Intergenic
1136982212 16:35068051-35068073 CTGAGGATGAGGTGGGACTGTGG + Intergenic
1138746436 16:59367990-59368012 CCATGGATAAGGGGAAACTATGG - Intergenic
1142478052 17:201401-201423 CTGTGGATCTGGGGGGAATGGGG - Intergenic
1142652562 17:1364822-1364844 CTGTGGATAAGGGGGGATGATGG + Intronic
1143014444 17:3884151-3884173 CAGTGGACAAGGAGGGACTGAGG - Intronic
1147667921 17:42160301-42160323 CTGTGGACAAGGAGGGTCTGGGG + Exonic
1150333385 17:64312496-64312518 CTGTGTATACTCGGGGACTAAGG + Intergenic
1152010153 17:77707955-77707977 CTGTGGATCAGGGAGCACTGCGG + Intergenic
1152562718 17:81086635-81086657 CTGTGGACGAGGGGGGCCGAGGG - Intronic
1154194438 18:12255017-12255039 CTGGGGAGCAGGGGGGACAAGGG + Intronic
1155243645 18:23886791-23886813 TTATGGATAAGGTGGGACTTTGG + Intronic
1156510305 18:37630925-37630947 CTGGGGAAAAGGGGGGATGAAGG - Intergenic
1157928732 18:51795474-51795496 CTGTGGATAAGGGGGAACTATGG - Intergenic
1159825798 18:73208887-73208909 CTCTGGGGAAGGGGGGGCTAGGG - Intronic
1160591068 18:79944978-79945000 CTGTTGATAAGGGGGTGCTGAGG - Intronic
1160831713 19:1107499-1107521 ATGTGGATGAGAGGGGACGAGGG - Intergenic
1161212409 19:3074264-3074286 CTGGGGATACCGGGGGACTGTGG + Intergenic
1161237290 19:3204380-3204402 CAGTGGGTAAGGAGGGACAAGGG - Intronic
1163122347 19:15225613-15225635 CTGGGGATAAGGGAGGACAGAGG + Intergenic
1165213461 19:34253490-34253512 GTGTGGAGAAGGAAGGACTACGG - Intergenic
1165244989 19:34493637-34493659 CTGTGGAGCAGGCGGGACTCGGG + Intronic
1165811449 19:38614293-38614315 CTGGGGAGAAGGGTGGACAAGGG + Intronic
1166338437 19:42122670-42122692 CTGGGGGTAAGGGGGGAATTTGG - Intronic
1166965967 19:46529464-46529486 CTGGGGAGAAGGTGGGACTGCGG - Intronic
1166996239 19:46720936-46720958 CTGTGGACAGGAGGGGACCAGGG - Intronic
1168435682 19:56315181-56315203 CTGGGAATAAGGCGGGACCAGGG + Intronic
925382879 2:3438644-3438666 CTTTGGAAAAGGGGAAACTATGG - Intronic
927174709 2:20397649-20397671 CACTGGATAAGAGGAGACTATGG + Intergenic
929573129 2:43035554-43035576 CTGAAGATAAGAGGGGACTACGG + Intergenic
930380434 2:50621252-50621274 TTGTGGAGAAGGGGGGAGAAAGG + Intronic
930640119 2:53845792-53845814 CCAAGGATAAGGGGGGACTATGG - Intergenic
931488766 2:62722077-62722099 TTATGGGTAAGGGGGCACTATGG - Intronic
932740222 2:74285488-74285510 CTATGGATATGGAGGGACAATGG + Intronic
932909618 2:75792010-75792032 CTGTGGAAGAAGGAGGACTATGG + Intergenic
933972981 2:87485153-87485175 CTGAGTATAAGTGGGGACCAAGG + Intergenic
936320740 2:111465060-111465082 CTGAGTATAAGTGGGGACCAAGG - Intergenic
940592632 2:155748768-155748790 CTGTGCATACGTGGGGACTATGG - Intergenic
940683032 2:156810036-156810058 CTGTGGATAAGGAGGACATACGG - Intergenic
941698647 2:168579932-168579954 CTATGGATTGGGGGGCACTAGGG - Intronic
942011161 2:171763600-171763622 CCATGGATAAGGGGGAACTAGGG - Intergenic
943600793 2:189918931-189918953 CTGTGGATAAGGGGGGACTATGG - Intronic
945949064 2:216021588-216021610 CTCTGGAAAAGGGGTGACTAGGG - Intronic
946997092 2:225405777-225405799 ATGTGGACAATGGGGGACAATGG + Intronic
947976602 2:234371770-234371792 CTGGGGAGCAGGGGGGATTATGG + Intergenic
948528366 2:238587424-238587446 CTGTGGGGGAGGGGGGACCAAGG + Intergenic
1172245536 20:33443185-33443207 CTGGGGGTAAGGGGGGTCTGAGG - Intronic
1173241843 20:41303830-41303852 GTGAGGATAAGAGGGGGCTATGG - Intronic
1176098268 20:63353859-63353881 CTGTGGTTCTGGGGGGACTGTGG + Intronic
1176913777 21:14600160-14600182 GTGTGCATAAGAGTGGACTATGG - Intronic
1178294579 21:31398331-31398353 CTGTGGATAAGCTGGGCCTGGGG + Intronic
1180758628 22:18181374-18181396 CTGTGGAGAAGGGGGGATTCCGG + Intergenic
1180768915 22:18365166-18365188 CTGTGGAGAAGGGGGGATTCCGG + Intergenic
1180777397 22:18497229-18497251 CTGTGGAGAAGGGGGGATTCCGG - Intergenic
1180810117 22:18754539-18754561 CTGTGGAGAAGGGGGGATTCCGG - Intergenic
1180826790 22:18868390-18868412 CTGTGGAGAAGGGGGGATTCCGG + Intergenic
1181196261 22:21188791-21188813 CTGTGGAGAAGGGGGGATTCCGG - Intergenic
1181213266 22:21304333-21304355 CTGTGGAGAAGGGGGGATTCCGG + Intergenic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1183186529 22:36294745-36294767 CTGTTCATAAGGGAGGATTATGG - Intronic
1203230537 22_KI270731v1_random:106050-106072 CTGTGGAGAAGGGGGGATTCCGG + Intergenic
1203276931 22_KI270734v1_random:94300-94322 CTGTGGAGAAGGGGGGATTCCGG + Intergenic
949168872 3:974484-974506 CCGTGGATAAGGGAGGACTACGG - Intergenic
949634723 3:5970074-5970096 CTAAGGATAAGGGAGGAGTAAGG + Intergenic
951281503 3:20755719-20755741 CTGTGGATAAGATGGGCATAAGG - Intergenic
961472763 3:127126766-127126788 CTGCAGATAAGAAGGGACTATGG + Intergenic
964065853 3:152577937-152577959 CTGTGGATAGTAGTGGACTATGG + Intergenic
964602832 3:158521358-158521380 CTGGGGATAAGGCAGGACAAGGG - Intronic
968449236 4:667332-667354 CTGGGGAGAAGGTGGGACAAGGG + Intronic
971391881 4:26193782-26193804 CTGAGCATAAGAGGGGGCTATGG - Intronic
973146972 4:46839382-46839404 CTGTGGAGAAGGAGGGGCTGGGG - Intronic
976231138 4:82844393-82844415 CTGTGGATAAGGTGGTACCTGGG + Exonic
976904551 4:90220286-90220308 CTGTAGATAAGGGGCAAATACGG + Intronic
981694454 4:147546156-147546178 GTGTGGAGAAGGGGGGAGAAAGG - Intergenic
982128552 4:152205897-152205919 CTTTGGGGAAGTGGGGACTAAGG - Intergenic
984285044 4:177718546-177718568 CTGCAGATGAGGGGGAACTACGG - Intergenic
984941578 4:184936743-184936765 CTCTGGAAAAGGTCGGACTAGGG + Intergenic
986623461 5:9701148-9701170 GTGTGGAGAAGGGGAGACAAGGG + Intronic
990187020 5:53220334-53220356 CTGTACATAAGGGGGAATTAAGG + Intergenic
993274261 5:85835958-85835980 CCCTGGATAAAGGGGGACTACGG + Intergenic
994307626 5:98226105-98226127 CTGAGGATGAGGGGAGAGTAGGG + Intergenic
997613151 5:135229238-135229260 GTATGGATAAGGGGGCACCAAGG + Intronic
997772139 5:136565113-136565135 CTGTGGAGAAGAGGGGACAATGG - Intergenic
1001562719 5:172679846-172679868 GGGTGTATAAAGGGGGACTAAGG - Intronic
1001946378 5:175781839-175781861 CTATGGTTAAGGGGGGAAAATGG - Intergenic
1003898001 6:10625708-10625730 CCGTGGATAAGGGGGGCCTACGG - Intronic
1012546798 6:100428997-100429019 CTGTGGATAAGGGGGGACTATGG + Intronic
1013705642 6:112830840-112830862 CCCTGGATAAAGGGGGACTATGG - Intergenic
1014159717 6:118154002-118154024 CTGAGGATGAGGTGGGAATATGG + Intronic
1015994118 6:138980438-138980460 CTGTGGACAAGAGGGGAGAATGG - Intronic
1016817757 6:148319396-148319418 CCATGAATAAGGGAGGACTACGG - Intronic
1021827311 7:24568333-24568355 CCATGAATAAGGGGGGACTGGGG + Intergenic
1024660123 7:51485451-51485473 CCTCAGATAAGGGGGGACTACGG + Intergenic
1027333097 7:77120869-77120891 CGGTGGATAAGGGAGGACTACGG + Intergenic
1027547949 7:79554171-79554193 CTGCAGATAAGAGAGGACTACGG + Intergenic
1029782692 7:102750432-102750454 CGGTGGATAAGGGAGGACTACGG - Intronic
1031120616 7:117717445-117717467 TTGTGGATGCGGGGGTACTAAGG - Intronic
1031537281 7:122950843-122950865 CCATGGATAAAGGGGCACTACGG - Intergenic
1033818224 7:145101439-145101461 GTGTGGAAAGGGGGGTACTATGG - Intergenic
1036695598 8:10972699-10972721 CTGGGGAAAAGTGGGGACTGGGG + Intronic
1037748425 8:21664223-21664245 CTGTGGATATGGGGAGCCTGGGG - Intergenic
1040697967 8:50025029-50025051 CTGTGGATAAGGGCAGGCAAGGG + Intronic
1042272717 8:66971578-66971600 CTGTGGATTAGAGGTGAATAGGG - Intronic
1045227979 8:100269442-100269464 TTGAGGATAATGGAGGACTAGGG - Intronic
1046238342 8:111457055-111457077 CTGTGGACAAGGGAGCACCATGG + Intergenic
1049934007 9:483254-483276 CTGTGGATTAGAGGGGAGTATGG + Intronic
1051453369 9:17223292-17223314 CTGAGGGTAAGGGGGAACTACGG + Intronic
1052301635 9:26958805-26958827 GTGTGGATAAGGGGGCCCAAGGG + Intronic
1055807014 9:80107175-80107197 CAGTGGATAAGGGTGGACTGTGG + Intergenic
1056991417 9:91415088-91415110 CTGGGCACAAGGGGAGACTAGGG + Intronic
1061882066 9:133573570-133573592 CTGTGGATCTGGGGAGACTGAGG + Intronic
1062687466 9:137822084-137822106 CAGGGGAGAAGGAGGGACTAAGG - Intronic
1186050759 X:5592418-5592440 CCGTGGATAAGGGGGAACGACGG + Intergenic
1186693701 X:12006649-12006671 CTGTGGAGAAGGAGGGAGTCTGG - Intergenic
1186952045 X:14637307-14637329 CTGTGGATGGTGGGGAACTATGG + Intronic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1188487323 X:30697528-30697550 CTGTAGATAAGCAGTGACTATGG - Intronic
1193113166 X:77750306-77750328 GTGTGAATAAGGGGAGACTATGG + Intronic