ID: 1012548667

View in Genome Browser
Species Human (GRCh38)
Location 6:100448544-100448566
Sequence CTTGATCTCCGTGACGGCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 32}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012548665_1012548667 14 Left 1012548665 6:100448507-100448529 CCAGGCTGGCGCGGAACATAAAC 0: 1
1: 0
2: 0
3: 1
4: 31
Right 1012548667 6:100448544-100448566 CTTGATCTCCGTGACGGCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012548667 Original CRISPR CTTGATCTCCGTGACGGCGC TGG Exonic
912526944 1:110290507-110290529 CATGCTCTCTGTGACGGCACTGG - Intergenic
1067066106 10:43105162-43105184 CTTGAACTCCACCACGGCGCTGG - Exonic
1067099399 10:43323451-43323473 CTAGACCTCCGTGAAGGCTCAGG - Intergenic
1072191670 10:93081168-93081190 CTTGATCTCTGTGGCGGCTTAGG - Intergenic
1077434875 11:2534167-2534189 CTGGGCCTCCGTGACGGCCCTGG + Intronic
1077916035 11:6612064-6612086 CTTGTTCTCCGCGGCGGTGCTGG + Exonic
1081709728 11:45209065-45209087 CTTAATGTCCTTGACGGAGCGGG - Intronic
1093218296 12:16388439-16388461 CTTCAGCTCCGTGACGATGCTGG - Intronic
1104568121 12:129903372-129903394 CTTGTTCGCCTGGACGGCGCCGG - Exonic
1118761975 14:68885517-68885539 CTTGATCTCCGAGAGGGTGGCGG + Exonic
1136137384 16:28264888-28264910 CTTGGTTTCCGTGACTGCCCAGG - Intergenic
1143019162 17:3907763-3907785 CTTGCTCTCCCTGATGGGGCTGG - Intronic
1152801548 17:82333223-82333245 CTTGGTCGCAGCGACGGCGCAGG + Intronic
1160983678 19:1827841-1827863 CTTGATCTCAGGGTCGGCCCTGG + Exonic
925375138 2:3378748-3378770 ATTGATCTCCGTGACGGAAATGG + Intergenic
926018535 2:9474824-9474846 CGTGACCTCCGGGACGCCGCGGG - Intronic
930224726 2:48780603-48780625 CTTGATGTCCGTGAAGACGGTGG - Intergenic
944889090 2:204098458-204098480 CTTGATTTCCCTGACTGCGTGGG + Intergenic
948542169 2:238698889-238698911 CTTCATCTCCATGACTGCCCTGG + Intergenic
1175166648 20:57048836-57048858 CATGATCTCCCTGATGGCCCAGG - Intergenic
1176904539 21:14483674-14483696 CTTGATCTCCCTGAGGCAGCAGG + Intergenic
1178314787 21:31558941-31558963 CGGGATCTCCGCGACGGGGCCGG + Exonic
1178882654 21:36461387-36461409 CTTCATCCCGATGACGGCGCAGG + Exonic
1178919008 21:36726231-36726253 CTTGATCTCGGTGATGGCACTGG - Exonic
1178976865 21:37227766-37227788 CTGAATCTCCGTGGCGTCGCGGG + Exonic
1179896622 21:44366837-44366859 CTTGATCTCGGTGACCGGGGGGG + Exonic
952748606 3:36805157-36805179 CTTGATCTCTGAGAAGGCCCAGG - Intergenic
955769584 3:62374033-62374055 CTTGCTCTCCGTGACGCTTCGGG - Intronic
992834219 5:80624240-80624262 CTTTATCCCTGTGACGGCGGGGG + Intergenic
1003139042 6:3456407-3456429 CTGGATCTCCGCGCCGCCGCCGG + Exonic
1012548667 6:100448544-100448566 CTTGATCTCCGTGACGGCGCTGG + Exonic
1022048606 7:26643632-26643654 CTTGGTCTCAGTGGCGGCGGGGG + Intronic
1023125513 7:36950749-36950771 CTTCATCTCCATGAGGGCTCAGG + Intronic
1187602925 X:20851771-20851793 CATGCTCTCTGTGACGGCACTGG - Intergenic