ID: 1012554347

View in Genome Browser
Species Human (GRCh38)
Location 6:100493356-100493378
Sequence GTATAGCCGCGGGGCAGAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012554336_1012554347 21 Left 1012554336 6:100493312-100493334 CCCTGTAGTCCAAAGAGAGTAAC No data
Right 1012554347 6:100493356-100493378 GTATAGCCGCGGGGCAGAGCCGG No data
1012554337_1012554347 20 Left 1012554337 6:100493313-100493335 CCTGTAGTCCAAAGAGAGTAACA No data
Right 1012554347 6:100493356-100493378 GTATAGCCGCGGGGCAGAGCCGG No data
1012554335_1012554347 22 Left 1012554335 6:100493311-100493333 CCCCTGTAGTCCAAAGAGAGTAA No data
Right 1012554347 6:100493356-100493378 GTATAGCCGCGGGGCAGAGCCGG No data
1012554339_1012554347 12 Left 1012554339 6:100493321-100493343 CCAAAGAGAGTAACAGGCATCTC No data
Right 1012554347 6:100493356-100493378 GTATAGCCGCGGGGCAGAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012554347 Original CRISPR GTATAGCCGCGGGGCAGAGC CGG Intergenic
No off target data available for this crispr