ID: 1012561737

View in Genome Browser
Species Human (GRCh38)
Location 6:100589469-100589491
Sequence GACTAAGATACCCATAGATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 95}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012561737_1012561740 21 Left 1012561737 6:100589469-100589491 CCTTATCTATGGGTATCTTAGTC 0: 1
1: 0
2: 1
3: 9
4: 95
Right 1012561740 6:100589513-100589535 ACCTTGTTTGACAGAGGAAAGGG 0: 1
1: 0
2: 1
3: 20
4: 237
1012561737_1012561739 20 Left 1012561737 6:100589469-100589491 CCTTATCTATGGGTATCTTAGTC 0: 1
1: 0
2: 1
3: 9
4: 95
Right 1012561739 6:100589512-100589534 GACCTTGTTTGACAGAGGAAAGG 0: 1
1: 0
2: 0
3: 12
4: 193
1012561737_1012561738 15 Left 1012561737 6:100589469-100589491 CCTTATCTATGGGTATCTTAGTC 0: 1
1: 0
2: 1
3: 9
4: 95
Right 1012561738 6:100589507-100589529 GTAGTGACCTTGTTTGACAGAGG 0: 1
1: 0
2: 0
3: 7
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012561737 Original CRISPR GACTAAGATACCCATAGATA AGG (reversed) Intronic
912073050 1:105838540-105838562 TATTAAGATACCCATAAATATGG + Intergenic
912321823 1:108720735-108720757 GACACAGATACACATATATAGGG - Intronic
920779866 1:208978835-208978857 GACTGTGATACCCATTGATACGG + Intergenic
921362563 1:214343400-214343422 GACTAAGACAGACATTGATAGGG - Intergenic
922625790 1:227040833-227040855 GACTAAGATACCTTTAACTATGG - Intronic
923313115 1:232755274-232755296 GAGTAATATAGCCATAGATGGGG - Intergenic
923313213 1:232755955-232755977 GAGTAACATAGCCATATATAAGG - Intergenic
923313816 1:232760042-232760064 GACTAACATAGCCATATATGGGG - Intergenic
923405588 1:233655862-233655884 GACTAAGATACCCTTGGATGAGG + Intronic
1064807807 10:19157166-19157188 GTCTGAGATACACATAGCTAAGG + Intronic
1072207824 10:93220712-93220734 GACTAAGACAAACATAGATGGGG + Intergenic
1073919336 10:108441140-108441162 GCCTCAGACACCCGTAGATATGG + Intergenic
1087308572 11:96513361-96513383 CTCTAAGATAGCCATAGACAGGG + Intergenic
1088349851 11:108873501-108873523 GACAAAGATAACCACAGATTAGG - Intronic
1088447030 11:109942272-109942294 ACCTAAGATACCCATAATTATGG - Intergenic
1092807135 12:12234956-12234978 GACTAAGATACCTATAGAGAAGG + Intronic
1096692916 12:53332191-53332213 GAGGCAGATACCCAGAGATATGG + Intronic
1098707763 12:73713041-73713063 GACTGTGGTAGCCATAGATAAGG - Intergenic
1101644624 12:106619546-106619568 GACTATGATGTGCATAGATATGG + Intronic
1102369506 12:112370400-112370422 AACTAAGATACTCATCAATAGGG + Intronic
1114635980 14:24187084-24187106 GACTCTGATCCCCATAGATGAGG - Exonic
1116481286 14:45393934-45393956 CACTGAGATAGCCAGAGATATGG + Intergenic
1118067292 14:62206129-62206151 GACTAATAGAACCACAGATAGGG + Intergenic
1118958583 14:70506383-70506405 GACTAAAATACCAATAGCAATGG + Intergenic
1119583453 14:75809341-75809363 AACAAAGATACTCATAGATTTGG - Intronic
1120549211 14:85848492-85848514 GACTTATATATCCATATATATGG - Intergenic
1120800493 14:88682882-88682904 GCCTGAGATACTCAAAGATAAGG + Intronic
1121483536 14:94296155-94296177 GACTATGTTACCCCTTGATATGG + Intergenic
1125406522 15:39357906-39357928 GACTGAGAAACCGAGAGATAGGG - Intergenic
1126054635 15:44718537-44718559 GACTTAAATATCCATAGATTTGG - Exonic
1127284201 15:57518292-57518314 ACCGAAGACACCCATAGATATGG - Intronic
1131816857 15:96230983-96231005 TATTTAGATACCCAAAGATATGG + Intergenic
1133593817 16:7271768-7271790 GCCTAAGAGACCCTTAGCTATGG - Intronic
1133850491 16:9498997-9499019 GACTAAGACACCCATATTTATGG - Intergenic
1145905490 17:28514046-28514068 GACTAAGATTACAATAAATAGGG + Intronic
1150230492 17:63547095-63547117 GACTAAGACACCCAAACATGAGG + Intronic
1155716775 18:28953378-28953400 TATAAAGATACCCAAAGATATGG - Intergenic
1155816604 18:30318937-30318959 GAGTTAGATACACATAGATACGG + Intergenic
1163446826 19:17351849-17351871 GACAACGACACCTATAGATATGG - Exonic
1163884757 19:19955854-19955876 GACTGAGATAGCCTGAGATATGG + Intergenic
925608793 2:5685801-5685823 GACAAAGATACTGATAGAAAGGG + Intergenic
925754885 2:7123727-7123749 GACTAAGATAACCATCTCTATGG + Intergenic
927745067 2:25611519-25611541 GATTCAGACACCCATGGATATGG - Intronic
929056775 2:37885108-37885130 GACCAAGATCCCCACAGGTAAGG - Intergenic
933530846 2:83509661-83509683 TACTAACATACACATACATAAGG + Intergenic
940778037 2:157905056-157905078 GACTAAGATATCCCTAAAGAAGG - Intronic
941247219 2:163113920-163113942 GAGTAAGATTCCCATTGATATGG + Intergenic
941962757 2:171269809-171269831 GACTAATATACCCACCGAGAGGG - Intergenic
941996529 2:171606434-171606456 GACTAAGGCCCCCATAGGTAAGG - Intergenic
945064026 2:205933067-205933089 GATGAAGACACCCATAGATTTGG - Intergenic
945264397 2:207876544-207876566 GCCTAAGAGACCCATAAGTAAGG - Intronic
945787871 2:214266138-214266160 TACAAAGACACTCATAGATAAGG - Intronic
1175744351 20:61444533-61444555 CACAAAGATACACATACATACGG - Intronic
1175744353 20:61444795-61444817 CACAAAGATACACATACATACGG - Intronic
1177054453 21:16283452-16283474 GATTTAGATGCCCATGGATATGG - Intergenic
1184394092 22:44222384-44222406 GACTAAGACACCCACAGAAGAGG - Intergenic
956419372 3:69070511-69070533 GTCAAAGATACACAGAGATAAGG - Intronic
957632129 3:82729985-82730007 CACTAAAATACCCATAGGAAGGG + Intergenic
958681966 3:97342805-97342827 GATTAAGGTGCTCATAGATACGG - Intronic
958739607 3:98052877-98052899 GACTAACATAAACATAGGTAAGG - Intergenic
958795672 3:98704001-98704023 AAGTAAGATATCCACAGATAAGG - Intergenic
959410621 3:106016650-106016672 GACTAAGTTCCCCTTACATAGGG - Intergenic
961106299 3:124244690-124244712 GACTTAGATGCCCAGTGATATGG - Intronic
965105702 3:164349171-164349193 TAGGAAGATACCTATAGATAAGG - Intergenic
966171348 3:177084637-177084659 GAAGAAGATACCCATAGAGGTGG - Intronic
971534776 4:27735202-27735224 AAATAAGAAACACATAGATAAGG + Intergenic
971740674 4:30516514-30516536 GACTAAAACACCAATAGAAACGG + Intergenic
971792750 4:31189729-31189751 GACTAAGAACACAATAGATATGG - Intergenic
971991068 4:33894639-33894661 GAAAAAGATACACATATATATGG + Intergenic
976947453 4:90788005-90788027 GACTAAAATATGCACAGATAAGG + Intronic
977103450 4:92848422-92848444 GAATAAGGTACACATACATATGG - Intronic
978849325 4:113314070-113314092 GCCTAAAATATGCATAGATATGG + Intronic
983657625 4:170099030-170099052 TATTAAGATACCCAAAAATATGG - Intergenic
988484869 5:31660262-31660284 GAATAACATGCCAATAGATATGG - Intronic
989311583 5:40025072-40025094 GACTAAGTTTCCAATACATAAGG - Intergenic
994107796 5:95965809-95965831 AAGTAAGATACCTATAGTTAGGG + Intergenic
994765513 5:103911545-103911567 GACTAAAAGACTCATATATATGG - Intergenic
995446903 5:112254736-112254758 GACTGAGATATACAGAGATAAGG - Intronic
996377267 5:122824545-122824567 GATTTAAATACCCATAGATAAGG + Intronic
999483923 5:151973880-151973902 GACTCAAATACCTATGGATAAGG + Intergenic
1000787055 5:165558442-165558464 TACTAAGACACACATAAATATGG + Intergenic
1006272500 6:32974896-32974918 GACCAAGATACCCAGAAATCTGG - Intronic
1010112196 6:72250667-72250689 GACTAATATACCTATAAACAAGG - Intronic
1010756789 6:79674498-79674520 GACTTAGATACTTAGAGATATGG - Intronic
1011242729 6:85289189-85289211 GACTAAAATACCAAAAGCTATGG + Intergenic
1012561737 6:100589469-100589491 GACTAAGATACCCATAGATAAGG - Intronic
1014168462 6:118251937-118251959 GAGTAAAATACGCATAGATATGG + Intronic
1018323992 6:162644596-162644618 GAACAAGATTCCCATAAATACGG + Intronic
1023176716 7:37442669-37442691 GAATGAGATACCCAAAGAGAGGG + Intronic
1032376538 7:131425120-131425142 GATTAAGAAACCAATAGTTAAGG + Intronic
1032925749 7:136603115-136603137 TACTAAGATACCCAAAAATGTGG + Intergenic
1038480928 8:27901468-27901490 GACTAAGAAACCCTCAGACATGG + Intronic
1041968516 8:63709364-63709386 GACCAAAATACCCAAATATATGG + Intergenic
1043098345 8:76005569-76005591 GATTAAGATACAAATACATATGG + Intergenic
1043845301 8:85156373-85156395 GACTAAAATACCAATAGCAATGG + Intergenic
1044033277 8:87265038-87265060 GACTAAGATACCAAAAGCAATGG - Intronic
1047734151 8:127751104-127751126 GATCAAGATAACCATGGATAAGG - Intergenic
1051326314 9:15974033-15974055 AAGTTAGATACCCATATATATGG - Exonic
1052071503 9:24087457-24087479 GACTTAGATATCCATATATAGGG - Intergenic
1186926318 X:14336682-14336704 TATTAAGATACCCAAAAATATGG - Intergenic
1188366777 X:29325661-29325683 GACTAACACACTCACAGATAAGG - Intronic
1188604002 X:32005854-32005876 AAATAAGATACCCATATACATGG + Intronic
1190573360 X:51807827-51807849 GACTCACATAACCATACATAAGG - Intronic
1191962942 X:66723694-66723716 GACTAAAATACCCAAAGCAATGG + Intergenic
1193279518 X:79629756-79629778 GACTAATACACCCATAAAGAGGG + Intergenic
1193675110 X:84441204-84441226 GAAAAAGAAAACCATAGATAAGG + Intronic