ID: 1012566863

View in Genome Browser
Species Human (GRCh38)
Location 6:100667144-100667166
Sequence GTGTAGTATCAGTATGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 131}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012566863 Original CRISPR GTGTAGTATCAGTATGAAGA AGG (reversed) Intronic
900040835 1:462953-462975 GTGTGGTATCAAGATGTAGAAGG - Intergenic
900062265 1:697929-697951 GTGTGGTATCAAGATGTAGAAGG - Intergenic
907992166 1:59593651-59593673 GTATAATATCAGCTTGAAGAAGG - Intronic
909075901 1:71050096-71050118 GTGGAGTAACAGTGTGAAGCTGG + Intergenic
909783716 1:79583189-79583211 TTGTAGTATCAGTGTGATGCCGG + Intergenic
910070166 1:83204286-83204308 GAGTAGTATCAATAGGAATAGGG + Intergenic
910719091 1:90265873-90265895 GTGTAGGAGGAGGATGAAGATGG + Intergenic
912307883 1:108589432-108589454 GTGTAGTTTCAGTAAAAGGAGGG - Intronic
920780418 1:208985655-208985677 TTGTATTCTCAGCATGAAGAAGG - Intergenic
923509720 1:234639844-234639866 GTGTATTATGAGTGGGAAGAAGG + Intergenic
924417687 1:243875115-243875137 TTCTAGTATTATTATGAAGATGG - Intergenic
1068657385 10:59589649-59589671 CTGTAGTGTCAGGTTGAAGAGGG - Intergenic
1072952289 10:99858335-99858357 CTGTAGTTTGAGTATGTAGAGGG + Intergenic
1073739240 10:106387136-106387158 TTCTAGTCTCAGTATGTAGAAGG + Intergenic
1075058588 10:119238442-119238464 GTGTAGTATCAGAACAAAGAAGG - Intronic
1076967108 11:99182-99204 GTGTGGTATCAAGATGTAGAAGG - Intergenic
1077945411 11:6892000-6892022 GGGTAGCCTCAGTATGAAGGTGG + Exonic
1079413375 11:20210163-20210185 GTTTTGTTTCAGTATGAAGATGG - Intergenic
1080852508 11:36082145-36082167 GTGTTGTATCAGTCAGATGAGGG - Intronic
1080989438 11:37512500-37512522 ATGTACTATCACTATGAAGCAGG + Intergenic
1084158354 11:67329041-67329063 GATTAATATCACTATGAAGAGGG - Intronic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1088182585 11:107128913-107128935 GGGTTGGAGCAGTATGAAGAGGG - Intergenic
1088945437 11:114507391-114507413 TTTTGGTATCAGTATGAAGCTGG - Intergenic
1091535200 12:1400794-1400816 GTGTGTTATCAGCATAAAGATGG - Intronic
1091942957 12:4506688-4506710 GTTTAGTAATAGTAAGAAGATGG + Intronic
1092513445 12:9183169-9183191 GTATAATATCAGGATGAACAAGG + Intronic
1093351169 12:18104512-18104534 GTATAGTTTCAATATGAAGGTGG - Intronic
1094104247 12:26792980-26793002 GTTTAGTATCAGAAAGAAGGAGG - Intronic
1098096835 12:66965925-66965947 GTGAAGTGTCAGTATGGAGAAGG - Intergenic
1098489337 12:71057203-71057225 ATGTAGTGTCAGTTTGAAAATGG + Intronic
1099638223 12:85244662-85244684 TTGTGGTATCATTTTGAAGAAGG + Intronic
1099987939 12:89689776-89689798 GTGTACTATGTGTATGAGGAAGG - Intronic
1101616480 12:106342895-106342917 TTGCAGTATCAGAAGGAAGAGGG + Intronic
1101826581 12:108225115-108225137 TAGCAGTATCAGTATGAAAATGG - Intronic
1104142743 12:126004342-126004364 TTGTAGCCTCAGTATGAAAAAGG + Intergenic
1104621970 12:130321053-130321075 GTGTAATACCATAATGAAGAAGG - Intergenic
1106695288 13:32166349-32166371 GTCTAGTTTCTCTATGAAGATGG + Intronic
1111072763 13:83189549-83189571 GTGTATTATCAGTATGACTGAGG - Intergenic
1114264019 14:21060639-21060661 GGCTAGTAACAGTATGAAGATGG - Intronic
1120567850 14:86081590-86081612 GTGTAGTATCTGTCTGCTGAGGG - Intergenic
1132441066 15:101864653-101864675 GTGTGGTATCAAGATGTAGAAGG + Intergenic
1138971748 16:62152651-62152673 GTATAGTACCAGTATAAAGACGG - Intergenic
1139707206 16:68749380-68749402 GTGAAGTACCAGTTTAAAGAAGG + Intronic
1149427928 17:56572721-56572743 GTGTAGTATGAGTAGGTAAAGGG + Intergenic
1151076246 17:71276337-71276359 TTTTAGTAGCAGTAGGAAGAAGG - Intergenic
1155982914 18:32199331-32199353 GTGTTGAATAAGTAAGAAGATGG + Intronic
1159639173 18:70843314-70843336 ATGTAGGGTCAGTATGTAGAAGG - Intergenic
1159741067 18:72171369-72171391 ATGTAGTATCAGTGAGAAAAGGG + Intergenic
1159809575 18:73000904-73000926 GTGTAGTCTCAGTATAAAGATGG - Intergenic
1160643911 19:168805-168827 GTGTGGTATCAAGATGTAGAAGG - Intergenic
1163238570 19:16044083-16044105 TCTTAGTATCAGTATTAAGATGG + Intergenic
1167834781 19:52059435-52059457 GTGTTCTATCAATATGTAGAAGG + Intronic
929043561 2:37769875-37769897 GTGTAGTTACAGTATGAAGGCGG + Intergenic
930216660 2:48704375-48704397 GTTTAGTATCAGGATGATGCTGG + Intronic
930440223 2:51395144-51395166 TTTTGGTATCAGTATGATGATGG - Intergenic
932111314 2:69003715-69003737 GTGAAGTATCAAGGTGAAGATGG - Intergenic
935052129 2:99532873-99532895 GTGTGGGATCATTGTGAAGAAGG + Intergenic
936896118 2:117429671-117429693 GTGAAGTATCAAGAAGAAGATGG + Intergenic
938202649 2:129387967-129387989 GTGTAGAGTCATTATAAAGAAGG - Intergenic
943800947 2:192056847-192056869 GTGAAGCTTCAGTAAGAAGAAGG + Intronic
944591217 2:201219505-201219527 GTGTAGTAGCAGTAACAAGGTGG - Exonic
945932880 2:215873404-215873426 GTGTAGTTTCAGGTTGAAGTTGG - Intergenic
1169927847 20:10801782-10801804 GTGTGGTAGCAGGATGAAGTGGG - Intergenic
1176956360 21:15108834-15108856 GTGTTATATCAGTATCCAGATGG + Intergenic
1180997316 22:19971959-19971981 GTGGAGTATCCGTCTGTAGATGG + Exonic
950340080 3:12235605-12235627 TTGTAGCACCAGTATGAAGAAGG + Intergenic
952661995 3:35862958-35862980 GGGTAGTATAACTATGATGATGG - Intergenic
955185001 3:56706622-56706644 ATATAGTATCAGAATGAAAATGG + Intergenic
955208630 3:56920066-56920088 ATGTTGGATGAGTATGAAGAAGG - Intronic
957287715 3:78238712-78238734 GTTCTGTATCACTATGAAGAAGG - Intergenic
960200412 3:114827900-114827922 GTGTACTATCAGTAGAAACAAGG - Intronic
962072438 3:132045488-132045510 CTGTAGTATCATTATAAACAAGG + Intronic
964838707 3:160970303-160970325 GTATAATAACAGTAGGAAGAGGG + Intronic
965018328 3:163191020-163191042 GTGTAGTATGAGAAGGGAGATGG - Intergenic
965598880 3:170435559-170435581 GTTTAGTATCAGTTTGATGGAGG + Intronic
966295310 3:178413704-178413726 GTGTAGGAAGAGTATGAGGAGGG + Intergenic
966471331 3:180292549-180292571 TTTTAGTAAAAGTATGAAGAAGG - Intergenic
966538377 3:181061071-181061093 GTGGACTTTCAGTATGAAGAAGG + Intergenic
966988534 3:185204583-185204605 GTGCAGTATCCCTATGAAGTGGG - Exonic
970377481 4:15474037-15474059 GGGAAGTATCAGCATGCAGATGG + Intronic
970675772 4:18448660-18448682 GTGAAGTGACAGTAAGAAGATGG + Intergenic
973618153 4:52701521-52701543 GTGTAGTACCTGTATGAATTGGG - Intergenic
974730477 4:65858223-65858245 GTTTAGTATCAGGATGATGCTGG + Intergenic
975063338 4:70032602-70032624 CTCTAATATCAGTATGAATAGGG + Intronic
975899233 4:79130373-79130395 GCATAGTACCAGCATGAAGACGG - Intergenic
976202183 4:82590203-82590225 GTGTACCATCATTATGATGAAGG - Intergenic
977496503 4:97781587-97781609 CTTTAGTATCAGGATGATGATGG - Intronic
977572341 4:98641786-98641808 GTGTAGGAACAGTGTGCAGAGGG - Intronic
979045317 4:115855540-115855562 GTGTGGTATCAGGATGATGCTGG - Intergenic
982558678 4:156901367-156901389 GTGAAGGATTAATATGAAGAGGG + Intronic
984004060 4:174287100-174287122 GTGAAGAATCAGCATCAAGAGGG + Intronic
984042690 4:174756261-174756283 GTGTGGTATCAGTATTATGCTGG - Intronic
991119663 5:62997101-62997123 GTGAAGTAACAGTGAGAAGATGG - Intergenic
993858589 5:93105630-93105652 ATGAAGTATCAGAATGAAGGGGG - Intergenic
995553816 5:113307018-113307040 GTGTAGTATTAGCATAAGGATGG - Intronic
995963754 5:117878438-117878460 GTGTACTAGCTGTATGAACATGG + Intergenic
999349348 5:150853096-150853118 CTGTAAAAGCAGTATGAAGAGGG - Intronic
999397735 5:151240885-151240907 GTCTTGTTTCAGTAAGAAGAAGG + Intronic
999539834 5:152559300-152559322 GTGTAGCATCAGTATGGGGATGG + Intergenic
1001738155 5:174023850-174023872 GTGTGGTTCCAGGATGAAGAAGG - Intergenic
1002138428 5:177123053-177123075 GTGTAGTATTGGCATAAAGATGG + Intergenic
1002733010 5:181355974-181355996 GTGTGGTATCAAGATGTAGAAGG + Intergenic
1002751528 6:118130-118152 GTGTGGTATCAAGATGTAGAAGG - Intergenic
1007937813 6:45749325-45749347 GTATAGTTTTAGTATGAGGATGG + Intergenic
1008853416 6:56052357-56052379 CTGTAGGATCATTTTGAAGAAGG - Intergenic
1010935562 6:81856935-81856957 GGGTAGTGCCAGAATGAAGATGG - Intergenic
1012566863 6:100667144-100667166 GTGTAGTATCAGTATGAAGAAGG - Intronic
1012743880 6:103057746-103057768 TTTTAGTATCAGTATGAGGCTGG + Intergenic
1013124974 6:107174138-107174160 GTCCAGTATTAGGATGAAGAAGG + Intronic
1016473672 6:144402662-144402684 GTGTAGGACCAGTATGAAGAGGG + Intronic
1017968949 6:159292697-159292719 GTGTGGTATTAGCATAAAGATGG - Intergenic
1019150265 6:170000775-170000797 CTTTATTATCAGTATGAAAATGG - Intergenic
1019237261 6:170628291-170628313 GTGTTGTATCAAGATGTAGAAGG + Intergenic
1021362959 7:19739336-19739358 GTGTAATATAAGTATAAATAAGG + Intronic
1022545383 7:31183072-31183094 TTTTAGTATCAGTATGATGCTGG + Intergenic
1027287938 7:76669460-76669482 GAGTAGTATCAATAGGAATAGGG + Intergenic
1027741195 7:82008074-82008096 GTGAACTATCACTATGAAAAAGG - Intronic
1029194192 7:98793020-98793042 ATGTTGTATCAGTTGGAAGATGG + Intergenic
1029194198 7:98793102-98793124 ATGTTGTATCAGTTGGAAGATGG + Intergenic
1033740696 7:144273678-144273700 GTGTAGTATCAGAAAGGAGAAGG - Intergenic
1033753211 7:144375935-144375957 GTGTAGTATCAGAAAGGAGAAGG + Intronic
1035510506 8:178316-178338 GTGTGGTATCAAGATGTAGAAGG - Intergenic
1037058592 8:14477995-14478017 GTGCAGAATAATTATGAAGAAGG + Intronic
1039197079 8:35044485-35044507 TTGTAATAACAGTATTAAGAGGG - Intergenic
1039338326 8:36619522-36619544 GTGTGGTAACAGTGTGAAGTGGG - Intergenic
1046877035 8:119266584-119266606 GTGTAGGAGCAGAATGAAGGAGG + Intergenic
1047080231 8:121452261-121452283 GAGTAGTATCAGTTTCAAAAAGG - Intergenic
1047137886 8:122102415-122102437 GTGTGGTCTCAGTATACAGAGGG - Intergenic
1047346568 8:124034506-124034528 GGGTAGTATTAGTATGCACAGGG - Intronic
1048029650 8:130619314-130619336 GTTTGGTATCAGTATGATGCCGG + Intergenic
1051525067 9:18033734-18033756 TTATAGTATGAGTATAAAGATGG - Intergenic
1051992347 9:23166862-23166884 GTGCAAAATCAGTATTAAGAGGG + Intergenic
1053203297 9:36166838-36166860 GTGTAATATGAGTAAGAAAACGG + Intergenic
1059664716 9:116435665-116435687 GTTTAGAAACAGAATGAAGAAGG - Intronic
1062757416 9:138308300-138308322 GTGTGGTATCAAGATGTAGAAGG + Intergenic
1189102047 X:38200775-38200797 CTGTAGTAACAGTATTAACAGGG - Intronic
1193321078 X:80122244-80122266 GTTTAGCATCATTACGAAGAAGG - Intergenic
1193502824 X:82301010-82301032 CTTTAGTATCAGAATGAAGCTGG - Intergenic
1194418292 X:93639999-93640021 GTGTGGTACTAGCATGAAGAAGG + Intergenic
1196687202 X:118521409-118521431 GTGTAGTTTTTGTATGAAGGGGG + Intronic
1198479792 X:137030929-137030951 GTGGAGAATGAGGATGAAGAGGG - Exonic
1199293685 X:146133711-146133733 GTGTAGTACTAGTATAAGGATGG - Intergenic
1199494873 X:148441733-148441755 CTGTAGTCTCAGTCTGATGAAGG + Intergenic
1200385415 X:155885454-155885476 GTGTAGTATCAGTTTAAAATGGG + Intronic