ID: 1012569001

View in Genome Browser
Species Human (GRCh38)
Location 6:100699691-100699713
Sequence CAAAATGCTGATAATGATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 607
Summary {0: 1, 1: 15, 2: 60, 3: 106, 4: 425}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012568999_1012569001 4 Left 1012568999 6:100699664-100699686 CCTAGAGACTTGTTGAATGGCTT 0: 1428
1: 1886
2: 1423
3: 807
4: 580
Right 1012569001 6:100699691-100699713 CAAAATGCTGATAATGATTTGGG 0: 1
1: 15
2: 60
3: 106
4: 425
1012568998_1012569001 5 Left 1012568998 6:100699663-100699685 CCCTAGAGACTTGTTGAATGGCT 0: 234
1: 252
2: 195
3: 100
4: 232
Right 1012569001 6:100699691-100699713 CAAAATGCTGATAATGATTTGGG 0: 1
1: 15
2: 60
3: 106
4: 425

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012569001 Original CRISPR CAAAATGCTGATAATGATTT GGG Intronic
900723064 1:4191763-4191785 GGTAATGCTGATAATGACTTTGG + Intergenic
901479950 1:9518397-9518419 CAAAATGCTTCTAATGTTCTGGG + Intergenic
905607533 1:39316270-39316292 AAAAATGGTGACATTGATTTTGG + Intronic
908919180 1:69169587-69169609 CAAAATGCTGATAATGATATAGG + Intergenic
909038303 1:70620798-70620820 CAAAATGCTGGCAAGGAATTTGG - Intergenic
909104434 1:71391347-71391369 CAAAATGCTGATAGTGATACAGG + Intergenic
909236019 1:73153345-73153367 GAAAATGCTGATAGTGATAATGG - Intergenic
909480779 1:76127286-76127308 TAAAATGCTACTAATGATTTGGG - Intronic
909525130 1:76614019-76614041 CAAAATGCTTAAAATGTTTTGGG + Intronic
909752459 1:79179593-79179615 CAAAAGCCTGATAGTGATATGGG - Intergenic
909780057 1:79533329-79533351 CAAAATGCTTAAGATGAATTTGG + Intergenic
909954024 1:81754857-81754879 TTAAATGCTCATAATAATTTGGG - Intronic
909957563 1:81799571-81799593 CAAAATACTGATAGGTATTTAGG + Intronic
910357950 1:86381903-86381925 CAAAATGTTAACAATGATTTTGG + Intronic
910941297 1:92537838-92537860 CATAATGCTGAAAATGTTTTTGG + Intronic
911407731 1:97463659-97463681 AAAAATGCTGATAATGATAAGGG + Intronic
912033335 1:105277398-105277420 CAAAATGCTAATAAATGTTTTGG - Intergenic
912121607 1:106478856-106478878 CAAAATGCTGATGATGATATGGG + Intergenic
912267508 1:108173766-108173788 CAAAATGCTGATAGTAATATGGG + Intronic
913471843 1:119196106-119196128 CAAGATGGTGGTCATGATTTGGG + Intergenic
915087982 1:153401275-153401297 CAAAATTCTGATAAACATTAAGG - Intergenic
915369836 1:155339526-155339548 CAAAATGCTGATAATCATTGTGG - Intronic
918130623 1:181625016-181625038 CAAAATACTGATAATGCACTTGG - Intronic
918547343 1:185700129-185700151 CAAAATGCAGATTCTGATTCAGG + Intergenic
919409787 1:197228546-197228568 CAAAATGCTGATAGTAATATTGG - Intergenic
919574186 1:199286397-199286419 AAAAATGGGGATCATGATTTGGG - Intergenic
919616793 1:199818208-199818230 AAAAATCCTTATAATGACTTAGG + Intergenic
920008112 1:202848172-202848194 CCAGATGCTGACAATGAGTTGGG - Intergenic
921397660 1:214685913-214685935 CAAATAGCTGATTAGGATTTGGG + Intergenic
921705789 1:218322010-218322032 CAAAATGCTGAATATGCTTAAGG - Intronic
921996673 1:221426661-221426683 CAAAATGCTGATAATGATAATGG - Intergenic
923263302 1:232288098-232288120 TAAATTGCTGAGAATGACTTGGG + Intergenic
923360898 1:233210240-233210262 CAAAATGCTTAGTATGGTTTGGG - Intronic
924748970 1:246867781-246867803 GGAACTGCTGATAATGGTTTGGG + Exonic
1063981977 10:11461170-11461192 CAAAACACTGACAAAGATTTAGG - Exonic
1065102309 10:22342425-22342447 TTAAATGCTAACAATGATTTTGG + Intergenic
1065166188 10:22980175-22980197 AAAAATGCTGATAATAATTTAGG - Intronic
1065401167 10:25303089-25303111 GTAAATGCTGATAGTAATTTAGG + Intronic
1066273398 10:33845185-33845207 CAAAATGCTGATAATGATATGGG - Intergenic
1067783216 10:49224039-49224061 CAAAATGCTGATAATGATATGGG - Intergenic
1068367865 10:56075574-56075596 AAAAATGATGATAATGATGATGG - Intergenic
1068456212 10:57257043-57257065 CAAAAAGCCAATAATTATTTCGG - Intergenic
1068562304 10:58528653-58528675 CAAAATGTTGATTAGGAATTAGG + Intronic
1068778384 10:60892167-60892189 TAAAATGTCGATATTGATTTTGG - Intronic
1068881512 10:62054285-62054307 TGAAATGCTGAGAATGCTTTGGG + Intronic
1069403315 10:68073103-68073125 CAACATGCTTGTAATTATTTTGG + Exonic
1070174101 10:73955949-73955971 AAAAATCCTGATTTTGATTTTGG + Intergenic
1070255486 10:74810093-74810115 CAAAATGTTGATAATGTTTGCGG + Intergenic
1070818304 10:79339239-79339261 CAAAGTGCTGAGATTAATTTGGG + Intergenic
1071017501 10:81015337-81015359 TAAAAACCTGTTAATGATTTGGG + Intergenic
1071127302 10:82350199-82350221 CAAATCTCTGATAATGTTTTTGG - Intronic
1071409954 10:85379400-85379422 CAAGATACTGATAATCCTTTTGG - Intergenic
1072093787 10:92156325-92156347 AAAAATGAAGATAATGATGTTGG + Intronic
1072215719 10:93285789-93285811 CAAAATAATAATAATAATTTGGG - Intergenic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1073152200 10:101319735-101319757 CAAAATGCTGATAAGCCTGTGGG + Intergenic
1073260255 10:102184314-102184336 AAAAATGCTGATAATGGGTCAGG - Intergenic
1073670518 10:105582553-105582575 CAAGATTCTGATAATGATATTGG + Intergenic
1073929503 10:108558023-108558045 CTAAATGCTGATGAGCATTTTGG + Intergenic
1074083467 10:110186716-110186738 TCAAATGCTGATAAGGATGTGGG - Intergenic
1075538348 10:123290530-123290552 CAAAATGCACATGATGTTTTTGG + Intergenic
1076989532 11:264168-264190 CAAAATAATAATAATAATTTGGG + Intergenic
1077736923 11:4801083-4801105 CAAAATGCTGATAGAAATATGGG - Intronic
1078393275 11:10955140-10955162 CAAAATGCTGATAGGGATATGGG + Intergenic
1078836509 11:15035338-15035360 CAAACTGCTGCTACTGATTCGGG - Intronic
1079547441 11:21650320-21650342 CAAAATGCTGTCTATGAATTAGG - Intergenic
1079707443 11:23638295-23638317 CAAATTGCTGATAGTGATATGGG - Intergenic
1079838742 11:25367547-25367569 CAAAATGGTGATAATTATATGGG - Intergenic
1080204986 11:29717886-29717908 CAAAATGCTGATAATAATATGGG - Intergenic
1080362764 11:31535088-31535110 CAAAATGTACTTAATGATTTAGG - Intronic
1080509554 11:32954458-32954480 CAAACTACTAATAATGAATTGGG - Intronic
1080887417 11:36379137-36379159 CAAAGTGAGGATTATGATTTAGG - Intronic
1081122757 11:39286521-39286543 CAAAATACTGATAGCGATATGGG - Intergenic
1082177372 11:49076695-49076717 CAAAATGCTAATGATGATGGTGG - Intergenic
1082733212 11:56825391-56825413 CAAAATGCTGATAGTAATATGGG - Intergenic
1082904850 11:58295678-58295700 CAAATTGTAGACAATGATTTGGG + Intergenic
1085779965 11:79399144-79399166 AAAAATGCTGGGAATCATTTGGG - Intronic
1086688346 11:89759143-89759165 CAAAATGCTAATGATGATGGTGG + Intergenic
1086717514 11:90080802-90080824 CAAAATGCTAATGATGATGGTGG - Intergenic
1086992082 11:93314431-93314453 TAAAATGCTGATAGTGATATGGG - Intergenic
1087351100 11:97033509-97033531 AAAATTGCTGATTTTGATTTTGG - Intergenic
1087387917 11:97496381-97496403 CTAAGTGCTAATAATGATCTTGG - Intergenic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1087901112 11:103642310-103642332 CAAATTCCAGATAATGGTTTTGG + Intergenic
1088726570 11:112642602-112642624 CAAAATCATAATAATGATATGGG - Intergenic
1090314776 11:125776581-125776603 CAAAATGCTGATAATGTGGCAGG - Exonic
1090506603 11:127321514-127321536 TAAAATGCTGATAGTGTTATGGG - Intergenic
1090644899 11:128759499-128759521 CTAAGTGATGATAGTGATTTTGG + Intronic
1091486785 12:897246-897268 CAAATGGTTGATAATGTTTTAGG - Intronic
1092486003 12:8902533-8902555 CAAAATGCTGATAGCGATATAGG - Intergenic
1092564734 12:9652108-9652130 TAAAATATTGATAATGCTTTTGG + Intergenic
1092925962 12:13272498-13272520 CATAATGCTGAAAATAATTCTGG - Intergenic
1093294960 12:17378229-17378251 CAAAAAGCAGAAAATGCTTTTGG - Intergenic
1093863653 12:24198714-24198736 CAAAAGACTGTTAATGTTTTTGG + Intergenic
1094421250 12:30273439-30273461 CAAAATGCTGATAGTAATATGGG - Intergenic
1094738176 12:33259101-33259123 CAAAATGCTGTTAGTGAATGTGG + Intergenic
1095269582 12:40201784-40201806 CAAAATTCTGATAATTATTCTGG - Intronic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1095379923 12:41578396-41578418 CAAAGTGCTGATATTACTTTGGG + Intergenic
1097343751 12:58468239-58468261 AAAAATGGTGATAGTGATATGGG - Intergenic
1097628169 12:62026738-62026760 CAAAATTATGATAAATATTTTGG + Intronic
1097816827 12:64083570-64083592 GAAAATGATAATAATGAGTTTGG - Intronic
1098220784 12:68267575-68267597 CAAAATGGTTGTAAAGATTTTGG + Intergenic
1098419601 12:70280421-70280443 CGAATTGATGAAAATGATTTTGG + Intronic
1099474453 12:83091259-83091281 CAAAATGGTGATAATATCTTGGG - Intronic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099495611 12:83342710-83342732 CAAAATGCTGATAGTGGTATGGG + Intergenic
1099582586 12:84469949-84469971 CAAAATGTTGCTAAAGATTTGGG - Intergenic
1099607848 12:84828251-84828273 CAAAATGCTAATACTGATATGGG + Intergenic
1099655168 12:85479921-85479943 CAAAATGCTGGTAGTGATATGGG - Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1099883225 12:88494950-88494972 AAAAATGCTGAACATTATTTTGG - Intronic
1100237112 12:92672257-92672279 CAAAGTCCTGACAATGATTCTGG - Intergenic
1100501590 12:95179521-95179543 CAAGGTACTGATTATGATTTTGG - Intronic
1100579109 12:95921889-95921911 CAAAATGATTCTAGTGATTTGGG - Intronic
1100703583 12:97176464-97176486 TAAACTGCTGATAATGTTTTTGG - Intergenic
1101190359 12:102326181-102326203 TAAAATGCTGATAGTGATATGGG + Intergenic
1101479162 12:105080585-105080607 CAAAATGGTCATAATAATCTAGG + Intronic
1101526465 12:105535651-105535673 CAAAATGCTGATAGGGATATGGG - Intergenic
1102827956 12:115966260-115966282 ATAAATGCTGATCATGTTTTTGG - Intronic
1104142609 12:126003367-126003389 CAAAATGCTGATAGTGATGTAGG + Intergenic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1106255548 13:28019339-28019361 CAAAAAGCTAAAAATGAGTTTGG + Intronic
1107013746 13:35692725-35692747 CAAAATGCTGTGACTGAGTTGGG + Intergenic
1107234338 13:38150902-38150924 CCAAATGCTGGTAAAGATGTGGG + Intergenic
1107806688 13:44159936-44159958 TAAAATGCAGATGATGATGTTGG - Intronic
1109359703 13:61280214-61280236 CAAAATGCTAATAGTGATATTGG + Intergenic
1110007662 13:70293249-70293271 CAAAATGTTGATGGTGATATGGG + Intergenic
1110822759 13:79935673-79935695 GAAAATGCTGATAATCATAATGG - Intergenic
1111221242 13:85207840-85207862 CAAAGTGCTGATAGTGATATGGG + Intergenic
1111270772 13:85881330-85881352 CAAAATGCCATTAATGATTCTGG - Intergenic
1112298356 13:98208906-98208928 GAAAAGGCTGAGAATGAGTTAGG + Intronic
1112453625 13:99536523-99536545 CAAAGTGATGACACTGATTTGGG + Intronic
1112861455 13:103833063-103833085 CAAAATACTGATACTGATATTGG + Intergenic
1113233538 13:108242135-108242157 CAAAATGCTGCTGATGATCGAGG - Intergenic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114797321 14:25731153-25731175 CAAATTGCTGATGATAATGTTGG - Intergenic
1114917271 14:27284740-27284762 CAAAATGCTGATAAAGATTTTGG + Intergenic
1114961278 14:27893089-27893111 CAAAATGTTGATAATCATATGGG + Intergenic
1116147848 14:41098975-41098997 CAAAATGCTGATAGCAATATGGG + Intergenic
1116196141 14:41728067-41728089 GAAAATTCTGGTAATGATTTTGG + Intronic
1116377942 14:44227641-44227663 CTAAATGCATATAATGATTTGGG + Intergenic
1116627067 14:47278794-47278816 CAAAAAGCTAATAATAATGTAGG - Intronic
1116784036 14:49268240-49268262 CAAAATGCTGATAGTGATTTGGG + Intergenic
1116904509 14:50391948-50391970 CAAAGTGGAGATAATGATATGGG - Intronic
1119114084 14:72002251-72002273 CCAAATGCTGATAAAGAAATTGG + Intronic
1119412042 14:74438538-74438560 CAAATTGCTAATAATTATTGAGG + Intergenic
1120072723 14:80122036-80122058 CAAAATGCTGATAGAAATATGGG + Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1120790678 14:88578547-88578569 CAAAATTCTGATAATAACTAAGG - Intronic
1120799874 14:88676000-88676022 CAAAATGCTGATGATGACACAGG - Intronic
1121247946 14:92476467-92476489 AAAAATACTTTTAATGATTTAGG + Intronic
1121468519 14:94132281-94132303 CAAAAAGCTCATAATTATTTAGG - Intergenic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1123827176 15:24093734-24093756 CACAATGCTGATAGTGACATGGG - Intergenic
1123841782 15:24254613-24254635 CACAATGCTGATAGTGACATGGG - Intergenic
1123861159 15:24468067-24468089 CACAATGCTGATAGTGACATGGG - Intergenic
1124087712 15:26567027-26567049 CAAAATGCTAAAAATAATATTGG + Intronic
1125220650 15:37329915-37329937 CCAAGTACTGATAATTATTTAGG - Intergenic
1126234344 15:46365315-46365337 CAAAACCCAGATAATGATATTGG - Intergenic
1126378039 15:48016103-48016125 CAAATTACTCATAAAGATTTCGG - Intergenic
1126512954 15:49501292-49501314 CAAAATGCTGATACTGATATGGG + Intronic
1126603319 15:50450890-50450912 CATATTGCTGAGAATGCTTTTGG - Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1127000912 15:54503652-54503674 AGAAATGCTGATAATGAGTTTGG - Intronic
1127270346 15:57395344-57395366 CAAAAAGCAGCTAATGCTTTCGG + Intronic
1128098024 15:64973425-64973447 CAAAATGGTGGAAATGCTTTGGG - Intronic
1128221036 15:65968888-65968910 TAATATGCTCATGATGATTTGGG + Intronic
1128906912 15:71475497-71475519 TAAAATGCAGATCCTGATTTAGG + Intronic
1130704726 15:86222312-86222334 CAAAATAATGATTTTGATTTTGG - Intronic
1130762233 15:86832664-86832686 CAAAATGCTGACAGTGATATGGG - Intronic
1131368319 15:91858408-91858430 CAAAATGTTAATAATTATTAAGG + Intronic
1131410101 15:92200401-92200423 CAAAATGCTGATAGAAATATGGG + Intergenic
1131587506 15:93712027-93712049 CAACCTGGTGATACTGATTTTGG - Intergenic
1131974605 15:97932218-97932240 AAAAATGCTTATCAAGATTTAGG + Intergenic
1135555419 16:23432165-23432187 CAAAATCCTAAGAATGAATTAGG + Intronic
1135744850 16:25008149-25008171 CAAAATGGTGATAGGGATTGTGG - Intronic
1136662808 16:31780059-31780081 CAAAATGCTGGTAGTGATATGGG + Intronic
1138805832 16:60087180-60087202 CAAAAATCTGAAAGTGATTTTGG - Intergenic
1139041240 16:63001518-63001540 CAAAATGCTGATAGTAATGTGGG + Intergenic
1139083983 16:63561904-63561926 CAAAATGCTGATAATGATATGGG - Intergenic
1143287896 17:5804744-5804766 CATAATGCTGATTATCGTTTTGG + Intronic
1143931097 17:10426422-10426444 CAAAATGCTTTAAATAATTTGGG - Intergenic
1149216291 17:54358184-54358206 CAAAATGCTGATAAGCATTATGG - Intergenic
1149308571 17:55372602-55372624 CAAAATACTGATAATGAATATGG + Intergenic
1150206379 17:63411831-63411853 CAAAATGCTGTTAAAGATCAAGG + Intronic
1150989944 17:70245553-70245575 TAAAATGATGATAATGATAATGG - Intergenic
1152048501 17:77954821-77954843 CACTATGCTGATAATAATATTGG - Intergenic
1155103354 18:22636358-22636380 CAAAATTCTAATAATGGTTGTGG + Intergenic
1155947023 18:31865489-31865511 TAAAATGCTAATAAGGATTTGGG - Intronic
1156178196 18:34572468-34572490 CAAAAAGATGATAATAATATTGG - Intronic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1156278240 18:35605722-35605744 CAAAATGTTGATAATTACTGAGG - Intronic
1156714793 18:39994946-39994968 AAAAGAACTGATAATGATTTGGG + Intergenic
1157712652 18:49860416-49860438 TAAAATGGTGATAATGATGCTGG + Intronic
1158003972 18:52650980-52651002 CAATATGCTTTTAATAATTTAGG - Intronic
1158388643 18:57023825-57023847 AGAAATGCTGATAATAAATTAGG + Intronic
1158693307 18:59680981-59681003 CAAAAACCTGATAATTATCTGGG + Intronic
1158748879 18:60235469-60235491 AAAAATGCTGAAAAGCATTTTGG - Intergenic
1159411377 18:68080216-68080238 GAAAATGCTTTTAATTATTTAGG - Intergenic
1159497904 18:69229767-69229789 CAGATTGCTGATATTGAGTTTGG - Intergenic
1161538911 19:4837664-4837686 GAAAAGACTGACAATGATTTGGG + Intergenic
1163214385 19:15864848-15864870 CCCAATGCTGATAATTCTTTGGG + Intergenic
1166017420 19:39993266-39993288 TAAAATGCTGATAGTGATAACGG + Intronic
1168702307 19:58448257-58448279 CAAAATGCTGATAATGATATGGG + Intergenic
925638535 2:5965658-5965680 CAAAATGCCGATAGTGATATGGG - Intergenic
926132355 2:10311749-10311771 GATAATGGTGATAATGGTTTTGG - Intronic
926509909 2:13762011-13762033 GATAATGATGATGATGATTTGGG - Intergenic
927110198 2:19859064-19859086 CCAAATGCTGATCTTTATTTGGG + Intergenic
927114157 2:19885352-19885374 TAAAATCCTGATAATGAACTGGG - Intergenic
927622100 2:24672181-24672203 AAAAATGCTTAAAATGATTATGG + Intronic
927835248 2:26392048-26392070 CTAAATGCTGATTGTGGTTTAGG + Exonic
927977691 2:27351696-27351718 CAAGATTCTGAATATGATTTAGG - Intronic
928044138 2:27910524-27910546 CAAGGTGCTGATAATGTTCTGGG - Intronic
928591913 2:32825978-32826000 GAAAATGCTAATAAACATTTTGG - Intergenic
929081501 2:38126948-38126970 CAAAATGCTCATAGTGATATGGG + Intergenic
929612688 2:43283485-43283507 CAAAATGCTGACAGTGATATGGG + Intronic
929686778 2:44041969-44041991 CCAAATGTTGATAATGATTGAGG - Intergenic
930221599 2:48751884-48751906 GAAAATGCTAATAATAATTATGG - Intronic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
930952243 2:57156868-57156890 AAAAATGCTGATAGAGATATGGG - Intergenic
931045656 2:58349754-58349776 CAAAATGTTGATAATGTTGGGGG - Intergenic
931928862 2:67106369-67106391 CAAAAAGCAGACAATGGTTTGGG - Intergenic
932128849 2:69169317-69169339 CAAAATTCTGATAATAAGTTTGG + Intronic
932234187 2:70108057-70108079 CAGAATGGAGATAAGGATTTGGG + Intergenic
932427413 2:71647732-71647754 AAGAATGTTGATAATTATTTAGG + Intronic
933046104 2:77539308-77539330 CAAAATGCTGATTGTGATATGGG + Intronic
933084235 2:78035113-78035135 CTTAATTCTGATGATGATTTTGG + Intergenic
933121027 2:78538526-78538548 CCAAATGCTGATGAAGATGTAGG + Intergenic
933308888 2:80636360-80636382 CAAAATACAGTTAAAGATTTAGG + Intronic
935792355 2:106604712-106604734 TAAAATACTGAGAATCATTTCGG + Intergenic
936850889 2:116896334-116896356 AAAAATGCTGATAGTGATATAGG - Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
936974725 2:118207690-118207712 TAAAGTGCTGATTCTGATTTAGG + Intergenic
937659697 2:124416691-124416713 TAAAATGGTGATAATGATAATGG + Intronic
938019501 2:127894595-127894617 TAAAATGCTGAAGATGGTTTAGG - Intergenic
939482770 2:142770371-142770393 CAAAATGCTGATAGTGACATGGG + Intergenic
939889542 2:147720349-147720371 CCAACTGCTGAGAATGACTTTGG + Intergenic
940094294 2:149956617-149956639 CAAATTGCTGATGATGACTGAGG + Intergenic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940381829 2:153024027-153024049 CAAAATGCCTGAAATGATTTAGG + Intergenic
940594309 2:155770127-155770149 CAAAATGATGGTGATGATGTTGG - Intergenic
940621644 2:156120989-156121011 CAAAATGCTAATAGTGATATGGG + Intergenic
940900424 2:159121666-159121688 CAAAAAGATGTTAATGGTTTAGG + Intronic
941118802 2:161504561-161504583 GGAACTGCTGATAATGGTTTGGG + Intronic
941357254 2:164509723-164509745 TAAAATGCAGATACTGATTCAGG - Intronic
941542961 2:166809538-166809560 GAAAATGGTGAAAATTATTTAGG + Intergenic
941570359 2:167162117-167162139 CCGAATGCTGATAATGATACAGG - Intronic
941578647 2:167267894-167267916 CAAAATGCTGATAATGATATGGG + Intergenic
941650911 2:168091755-168091777 CAAAATGTTGATAATGTTGAAGG - Intronic
942979745 2:182066095-182066117 CAAAAAGCTGATAAGATTTTGGG - Intronic
943223583 2:185140695-185140717 CAAAAAGCCGATAGTGATGTGGG - Intergenic
943270384 2:185794510-185794532 CAAAAGGCAGATAATTGTTTTGG + Exonic
943808085 2:192148967-192148989 AAAAATGCTGAAAATGCTGTGGG - Intronic
944048999 2:195445226-195445248 AAAAAAGTTGATACTGATTTTGG - Intergenic
944210401 2:197201025-197201047 GAAAATTCTGAAAATGAATTAGG + Intronic
944403587 2:199356590-199356612 CCAAATGCAGATAAATATTTAGG + Intronic
945511642 2:210710226-210710248 CAAAATGCTGACTTTTATTTGGG - Intergenic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
945893837 2:215459743-215459765 CAAAATTTTGAAAATGAATTTGG + Intergenic
946713357 2:222528486-222528508 AAAAATGCTAACAATGATCTGGG + Intronic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
947889731 2:233606326-233606348 CAAAACGCTGATAAAAATATGGG - Intergenic
1170304838 20:14926919-14926941 CAAATTGATGATAATTATATTGG + Intronic
1170725164 20:18919682-18919704 CACAATGCTGATAGTGATATGGG + Intergenic
1172952764 20:38732402-38732424 AAAAATGATAATAATTATTTGGG - Intergenic
1173323519 20:42010746-42010768 CAAAATGCTGACAGTGATAATGG - Intergenic
1173559004 20:43989023-43989045 CAAAGTGCTTTTAATGATTCAGG + Intronic
1174468111 20:50732501-50732523 CAATCTGCTGATAATTACTTCGG + Intronic
1175359314 20:58395492-58395514 CTAAAGGATGATCATGATTTGGG + Intronic
1176657789 21:9603282-9603304 CAAAATGCTGATAATGATATGGG - Intergenic
1176669461 21:9718946-9718968 CAAAATAATGTAAATGATTTGGG + Intergenic
1176705001 21:10109065-10109087 CAAAATCCTTAGTATGATTTTGG + Intergenic
1177394180 21:20511550-20511572 TAAAATGCTGATAGTGATATGGG - Intergenic
1177455710 21:21334867-21334889 AAAAATATTGATAATTATTTGGG + Intronic
1177604557 21:23360804-23360826 CAAAACGCTGATAGTGATACGGG - Intergenic
1177614664 21:23501168-23501190 CAAAATGCTGGTAGTGATATGGG + Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1177992730 21:28058182-28058204 CTAAATGCTGACAATGATATGGG + Intergenic
1178143882 21:29716492-29716514 CAAAATGCTGATAGTAATGTGGG + Intronic
1178948851 21:36969414-36969436 CAAAATGCAGACGCTGATTTGGG - Intronic
1179156464 21:38855975-38855997 CAAAATGCTGATAATAATAGGGG + Intergenic
1180685776 22:17665327-17665349 CAAAATGCTGACAGTGATATGGG - Intronic
1182601341 22:31466701-31466723 AAAAATGCTTATGTTGATTTTGG + Intronic
1183456717 22:37926946-37926968 GAAAATGCAGATAATGTGTTTGG + Intronic
949168164 3:965621-965643 TGAAATGGTGATCATGATTTTGG + Intergenic
949185780 3:1189918-1189940 CAAAATGATGATATGAATTTAGG + Intronic
949356665 3:3188201-3188223 CAAAACACAGATATTGATTTTGG - Intergenic
950849197 3:16045877-16045899 AAAAATGCTGATAATGTATTTGG - Intergenic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
951218053 3:20042097-20042119 TAAAATGCTGATTATGAATCAGG + Intronic
952002604 3:28803832-28803854 CCAAATGCTGGCAAAGATTTGGG - Intergenic
952557483 3:34549402-34549424 CAAAATGAGGATAACGATTATGG + Intergenic
952648559 3:35693532-35693554 AAAATTGCTGACAATGATTCAGG - Intronic
952815687 3:37445583-37445605 CTAAATGTTAATAATGATTATGG - Intergenic
953141420 3:40232715-40232737 AAAAATGCAGATAATTCTTTGGG + Intronic
953503158 3:43457705-43457727 CAAAAAGCTTGTAATGAATTAGG - Intronic
955675566 3:61444679-61444701 CAAAAAGCTGATGAAGATATGGG - Intergenic
955920422 3:63948833-63948855 CTAAATCCTGAGAAAGATTTAGG + Intronic
957175674 3:76805018-76805040 CAAAATGCTCACAATATTTTGGG - Intronic
957791479 3:84946807-84946829 CTACATGTTGATAATGAATTAGG - Intergenic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
958813877 3:98894443-98894465 CAAATTGCTGGCACTGATTTAGG + Intronic
958987567 3:100800097-100800119 AATAATGCTGAAAATGCTTTTGG - Intronic
959124169 3:102270245-102270267 TATAATGCTGATAATGTTATTGG + Intronic
959225365 3:103575304-103575326 AAAAATGGTGATAGTCATTTAGG + Intergenic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
959260350 3:104071607-104071629 CAAAATGCTGATAAAAATCCAGG + Intergenic
959275931 3:104277653-104277675 CAAAATGATAATAATGAACTTGG - Intergenic
961937061 3:130595980-130596002 CCAAGTGCTGATAAGGATGTGGG + Intronic
962546896 3:136445937-136445959 TAAAATGCAGATTATCATTTGGG - Intronic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963433805 3:145242550-145242572 CAACATGCTGATAGTGATAAGGG - Intergenic
963524386 3:146398206-146398228 CAACATCCAGATAATAATTTGGG - Intronic
963539566 3:146567790-146567812 CAAAATGATGATAGTGATATGGG - Intergenic
963570259 3:146985797-146985819 AAATATGATGATAATTATTTAGG - Intergenic
963680312 3:148366446-148366468 CAAAATGCACATATAGATTTAGG - Intergenic
964520830 3:157564453-157564475 CAAAATGCTGATAGTGATACGGG - Intronic
965032922 3:163396554-163396576 CAAAATGTTGGAAAGGATTTAGG - Intergenic
965326460 3:167310228-167310250 CAAAATGCTTATAGTGATAATGG - Intronic
965349305 3:167594280-167594302 CAAAATGTTCATAGTGATATGGG + Intronic
965736015 3:171822038-171822060 CCAAATGCTGAGCATGATTTTGG + Intergenic
966075783 3:175935602-175935624 CAAAATGCAGGTAGTGATATGGG + Intergenic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
967704774 3:192637152-192637174 CGGAATGCTGACAATGCTTTTGG + Intronic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
969504034 4:7572659-7572681 AAAAATGATGCTGATGATTTAGG - Intronic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
970823019 4:20241533-20241555 TAAAATGCCTTTAATGATTTGGG - Intergenic
970968466 4:21954107-21954129 TAAAATGATGATAGTGATTAAGG - Intergenic
971546205 4:27890522-27890544 CAAAATGTTGATAGTGATATGGG + Intergenic
971590167 4:28457353-28457375 AAAAATTCAGATTATGATTTTGG - Intergenic
971972478 4:33637752-33637774 CAAAATGCTGATAGAGAATAAGG - Intergenic
972155194 4:36152592-36152614 CAACCTGCTGATTATCATTTTGG - Intronic
972840684 4:42927020-42927042 CAGAATAATAATAATGATTTGGG - Intronic
972896022 4:43620928-43620950 CAAAATGCTGATAGTAATATGGG - Intergenic
973539345 4:51920632-51920654 CTAAATGCTGATGAGGATATAGG - Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
974272573 4:59670328-59670350 TGAAATGCAAATAATGATTTTGG + Intergenic
974637921 4:64589675-64589697 CAGAATGCTGATAGTGATATGGG + Intergenic
974724105 4:65777061-65777083 CAAAATTCTGATAATGATACGGG + Intergenic
975489358 4:74971520-74971542 CAAAATGCTGTTAATAAAATAGG - Intronic
976023718 4:80662556-80662578 CAAAATGCTGCTACTTAATTTGG + Intronic
976277918 4:83296854-83296876 TAAAATGGTTATAATGACTTAGG - Intronic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
978182848 4:105822041-105822063 GAAAATCCTGATAATCTTTTTGG - Intronic
978595076 4:110368704-110368726 AAAAATGCTGATAATGAAACTGG - Intronic
979060987 4:116059935-116059957 CAAAGTGCTGATAGTGATGTGGG - Intergenic
979125708 4:116969397-116969419 CAAAATGCTAATAGTGCTATTGG - Intergenic
979423857 4:120540163-120540185 CAAAATGCTTATAGTCATGTTGG - Intergenic
979840866 4:125438033-125438055 TAAGTTTCTGATAATGATTTTGG + Intronic
980188570 4:129494308-129494330 CAAAATGGTGCACATGATTTAGG - Intergenic
980755591 4:137155474-137155496 CAAATTGCTGATCAGGAGTTGGG + Intergenic
981263908 4:142757838-142757860 CAAAATAGTGAAAATGCTTTGGG - Intronic
981343249 4:143647051-143647073 TAAAATGTTGATAGTGATATGGG + Intronic
981391464 4:144196361-144196383 CAAAATGCTGATAGTGATACAGG + Intergenic
981503193 4:145474189-145474211 CAAAATGCTAATAGTGATATGGG - Intergenic
981694314 4:147544479-147544501 CAGATTGCTGATAATAAATTAGG + Exonic
981842887 4:149132918-149132940 TAAAATGCTGATAGTGATATGGG + Intergenic
981843784 4:149143643-149143665 CAAAGTGTTGAAAATGGTTTGGG - Intergenic
982210281 4:153029194-153029216 CAAAATGCTGATAGAAATATGGG - Intergenic
982262835 4:153510117-153510139 CCAAAGGCTGATACTAATTTGGG - Intronic
982762231 4:159299075-159299097 CAAAACCCTGACAATGATATGGG + Intronic
983320427 4:166190070-166190092 GAAAATGCTGATAATGATATGGG + Intergenic
983379032 4:166967892-166967914 CAAAATGCTGATAGTGATGTGGG + Intronic
983660360 4:170125563-170125585 TAAAATGCTGATAATGATATTGG + Intergenic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
984131358 4:175879139-175879161 CAAAATGCTAATAATGATATGGG - Intronic
984368829 4:178834751-178834773 CAATCTGCAGAAAATGATTTCGG + Intergenic
984454619 4:179948752-179948774 CAAAATTATGCTAATGATTGTGG + Intergenic
984512358 4:180694017-180694039 CAAAATACTAATAGTGATATAGG - Intergenic
985009665 4:185569469-185569491 CAGAATGGTGACAATGAATTGGG - Intergenic
985405310 4:189632524-189632546 CAAAATAATGTAAATGATTTGGG - Intergenic
985417621 4:189752804-189752826 CAAAATGCTGATAATGATATGGG + Intergenic
985944422 5:3166251-3166273 CAAAAAGTTGCTATTGATTTTGG + Intergenic
986260081 5:6136542-6136564 CAAAAGGCTGAGAATACTTTTGG - Intergenic
986537426 5:8805375-8805397 CAAAATGCTGATAGTAATATGGG + Intergenic
986911693 5:12565592-12565614 CAAAATGTCGATAATGATATTGG - Intergenic
987230487 5:15888796-15888818 CTAAATCCTGATAATAAATTTGG + Intronic
987533209 5:19148797-19148819 CAAAATGCTGATAGTGACGAGGG - Intergenic
987615805 5:20273019-20273041 CTATATGCTGATAATCATTTAGG + Intronic
987756248 5:22100083-22100105 CAAAATAGTGGTAAAGATTTGGG - Intronic
987918647 5:24249435-24249457 CAAAATGCTGACAGTGACATGGG - Intergenic
987931989 5:24413382-24413404 CTAAATTCTGATGAGGATTTTGG - Intergenic
988009510 5:25464379-25464401 CATAATGCTGATAGTAATATGGG + Intergenic
988038849 5:25861985-25862007 CAAAATGCTGATAGTAATATGGG - Intergenic
988076760 5:26363821-26363843 CAATATGCTGATAGTGATAAGGG + Intergenic
988456307 5:31390007-31390029 CAAAATGCTAATAGTGATATGGG - Intergenic
988876866 5:35456644-35456666 CAAAATGCTGATGGTGATAGGGG + Intergenic
989319087 5:40114150-40114172 TAAAATGCTGATACTGTGTTAGG + Intergenic
989677025 5:43984164-43984186 CAAAATGCTGACAGTGACATGGG - Intergenic
989817323 5:45751751-45751773 CAAAATGCTGATAGTGATAATGG - Intergenic
990028763 5:51229333-51229355 CTTAATCCTGGTAATGATTTTGG + Intergenic
990331542 5:54731101-54731123 CTAAATTCTGATCATAATTTAGG - Intergenic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
990933762 5:61123977-61123999 CAAAATTATAATAATTATTTGGG + Intronic
991074707 5:62522178-62522200 CAAAATGCTGATCTTGAAGTTGG - Intronic
991186487 5:63814842-63814864 CAAAATGCTGATAGTGACATGGG + Intergenic
991259019 5:64646691-64646713 AAAAATGCAGAAAATGACTTTGG - Intergenic
991329179 5:65474130-65474152 CATTATGCTGATAACCATTTTGG - Intronic
991989464 5:72323231-72323253 CAAAATATTGATAATGATTGAGG + Intronic
992867923 5:80976407-80976429 CCAAATGCTGTTATTAATTTTGG - Intronic
993001036 5:82380593-82380615 CAAAATGCTGATAATGATATGGG - Intronic
993082660 5:83320749-83320771 AAAAATGCTAATAATCATCTGGG - Intronic
993269542 5:85776473-85776495 AAAAATGGTGATAATAATGTTGG + Intergenic
993574217 5:89581251-89581273 CAAAATGCTTACATTAATTTAGG - Intergenic
993792625 5:92225203-92225225 CAAAATACTGATAGTGAGATGGG - Intergenic
993913822 5:93717282-93717304 GAAAATGCTGAGAATGAGGTAGG + Intronic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994849569 5:105036671-105036693 CAAAACCCTGATAGTGATATGGG - Intergenic
994877808 5:105447830-105447852 CAATTTGCTGATAAATATTTGGG + Intergenic
995211964 5:109550959-109550981 CAAAATGCTGATAGCCATATGGG + Intergenic
995770199 5:115661211-115661233 CAAAACGCTCAGAATGATTGGGG + Intergenic
995837926 5:116416546-116416568 CAAGATGTTGACAATGCTTTAGG - Intergenic
996205358 5:120728245-120728267 CTTAATGCTTATAATTATTTGGG - Intergenic
996809336 5:127497419-127497441 CCAAATGCTGACAAGGATGTGGG + Intergenic
996988002 5:129591605-129591627 AAAAATGCTGAGTATGACTTTGG - Intronic
999364920 5:151016582-151016604 CAAAATGGGGATAATAATGTTGG + Intergenic
999555700 5:152739777-152739799 CAAAATCAGGAAAATGATTTAGG + Intergenic
1000363221 5:160467339-160467361 CAAAATGGAGATAATAATTCGGG + Intergenic
1000609540 5:163359281-163359303 CAAAATGCTGATAGTGATAATGG + Intergenic
1000763592 5:165256993-165257015 CAAAATGTTGACTATGACTTGGG + Intergenic
1000768416 5:165319765-165319787 CAAAAAGCTGATAGTGATATGGG - Intergenic
1000788141 5:165571317-165571339 GAAAATGTTGATAATGATGTGGG - Intergenic
1002045649 5:176540453-176540475 CAAAATCCTGCTTATGCTTTGGG + Intergenic
1002650860 5:180692292-180692314 CTAAATGCTGCTTAGGATTTGGG - Intergenic
1003798236 6:9630197-9630219 CCAAATGCTGATAGTGACATGGG + Intronic
1005512845 6:26527119-26527141 CAAAATACTAATAAAGCTTTGGG + Intergenic
1005759226 6:28952322-28952344 GGAAATGCTGTTAAAGATTTGGG - Intergenic
1006344060 6:33465786-33465808 CAAAATGCTGATAGCAATATGGG + Intergenic
1008284012 6:49627405-49627427 CAAAATGGTGATAGTGAGATGGG - Intronic
1008445664 6:51587080-51587102 CAAAATGTTGATAGTGAATATGG - Intergenic
1009031988 6:58070237-58070259 AAAAACACTGATAATGTTTTTGG - Intergenic
1009207814 6:60824689-60824711 AAAAACACTGATAATGTTTTTGG - Intergenic
1009294008 6:61920875-61920897 TAAAATGCTTATAATAAATTAGG + Intronic
1009635004 6:66253751-66253773 CCAAATGCTGATAATGATATGGG - Intergenic
1009647770 6:66428670-66428692 AAAGATGCTGGGAATGATTTGGG + Intergenic
1009732082 6:67621728-67621750 AAAAATACTGATAATGATATGGG + Intergenic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1010898661 6:81398728-81398750 TAAATTGATGGTAATGATTTGGG - Intergenic
1011521227 6:88209037-88209059 GAAAATTCTGAGAACGATTTTGG - Intergenic
1011819454 6:91234356-91234378 TAAAATGCAGATGATGATATTGG - Intergenic
1012015689 6:93847182-93847204 CAAAATGCTGATAGAAATTAAGG + Intergenic
1012084365 6:94805243-94805265 CAAAGTCCTTATAATGATATAGG - Intergenic
1012120993 6:95366685-95366707 CAAAATACTGATAGTGATATGGG - Intergenic
1012184650 6:96197726-96197748 CAACATCCTGCTAATGATGTTGG + Intronic
1012569001 6:100699691-100699713 CAAAATGCTGATAATGATTTGGG + Intronic
1012765499 6:103362467-103362489 CAAAATGCTCATAGTGATATGGG + Intergenic
1013489915 6:110636182-110636204 CAAGATGATGATGATGAATTTGG + Intronic
1013890608 6:115021850-115021872 CAAAATGCTGATAATGATATGGG - Intergenic
1014048235 6:116919853-116919875 CATAAAGCAGATAATCATTTTGG - Intronic
1014457258 6:121650258-121650280 CAAAATAGTAATAAGGATTTGGG + Intergenic
1014702169 6:124703432-124703454 CAAAATTCTGATATTTAGTTTGG + Intronic
1015061907 6:128976388-128976410 CTAGCTGGTGATAATGATTTGGG + Intronic
1015075224 6:129148614-129148636 CAAAATGTTGTTAATATTTTTGG - Intronic
1015239511 6:131007621-131007643 CAAAATGCTGATAGTAATATGGG + Intronic
1015662139 6:135588051-135588073 TAAAATGCAGATTTTGATTTAGG + Intergenic
1015695028 6:135970504-135970526 TAAAATGCTGATTTTGATTCAGG + Intronic
1015721942 6:136251397-136251419 AGAAAAGATGATAATGATTTGGG + Intergenic
1016073942 6:139774275-139774297 CAAAATGCGGATAAGGGTTCGGG + Intergenic
1016427417 6:143949269-143949291 CAGAAGGATGATAATGATTTGGG - Intronic
1016842962 6:148543078-148543100 CAAAATACTGATAAAGTTTTAGG - Intronic
1016851365 6:148622545-148622567 TAAAATGCTGATCATGACCTGGG + Intergenic
1016876365 6:148869661-148869683 ATAAATGCTGATGCTGATTTAGG - Intronic
1017331692 6:153206928-153206950 ATACATCCTGATAATGATTTTGG + Intergenic
1017431682 6:154377674-154377696 CAAATTGCAGATAATCATTGTGG - Intronic
1017834067 6:158160892-158160914 CAAAATGTTGGTAAATATTTAGG - Intronic
1018456475 6:163958231-163958253 CAAAATGGTCAGAATGATTAGGG + Intergenic
1018507937 6:164491483-164491505 CAAAATGCAAATGAAGATTTGGG + Intergenic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1019804184 7:3110795-3110817 CCAAATGCTGACAAAGATGTGGG + Intergenic
1020725555 7:11809208-11809230 CAAATTACTGGTAATGATTTTGG - Intronic
1020933269 7:14427337-14427359 CAAACTGCTGATAGTGATATGGG - Intronic
1021020370 7:15590863-15590885 CAAAATTCTGACAATGTTTTTGG + Intergenic
1021207470 7:17801732-17801754 TCAAATGCTGATACTCATTTAGG - Intronic
1022021758 7:26406345-26406367 CAAAATCCTGACAGTAATTTGGG - Intergenic
1022894477 7:34735727-34735749 AAAACTGCTGATAAAGCTTTTGG + Intronic
1022947858 7:35305209-35305231 CAAACTGCTTATAATAATGTGGG + Intergenic
1023339052 7:39199832-39199854 CAAAATACTGATTAGGAGTTTGG - Intronic
1023771343 7:43559419-43559441 CATGATTGTGATAATGATTTGGG - Intronic
1024183444 7:46922306-46922328 TAAAATGCTGTTTATAATTTGGG - Intergenic
1024301847 7:47892921-47892943 AAAGATGCTGGTAAAGATTTTGG + Intronic
1024383614 7:48726149-48726171 CAATATGCTGATAATGATATGGG - Intergenic
1026210702 7:68301760-68301782 CAAAATGTGTATAAAGATTTGGG + Intergenic
1026238471 7:68550362-68550384 GAAAGTGCTGATTTTGATTTTGG - Intergenic
1027378453 7:77577925-77577947 CAAAATGTTGATAATGAAGCTGG + Intronic
1028661048 7:93275502-93275524 AAAAATGCTAATAATCATCTGGG - Intronic
1028768812 7:94591584-94591606 CCAAATGCTGATTTTGAATTTGG - Intronic
1029200055 7:98833413-98833435 AATAATGATGATAATGATGTTGG - Intergenic
1029997673 7:105024058-105024080 CAAAATGTTGGTAGTGAATTTGG + Intronic
1031261928 7:119532438-119532460 CAAAATTCTGATAGTGATGTGGG + Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1031808669 7:126338768-126338790 GAAAATGCTAAGAATCATTTTGG - Intergenic
1032927473 7:136624044-136624066 GAAAATGCTGATTCTGGTTTAGG + Intergenic
1032946596 7:136860677-136860699 CAAAATGCTTTTAATGTTATGGG + Intergenic
1033475986 7:141693348-141693370 CCAAATGCTGATGAGGATGTGGG + Intronic
1033620777 7:143060491-143060513 AAAAATGCAGATTCTGATTTAGG + Intergenic
1034510823 7:151533198-151533220 CAAAATGCTGATAATGATATGGG - Intergenic
1035639611 8:1174315-1174337 GGTAATGATGATAATGATTTTGG - Intergenic
1035639631 8:1174522-1174544 GGTAATGATGATAATGATTTTGG - Intergenic
1035639653 8:1174734-1174756 AGTAATGATGATAATGATTTTGG - Intergenic
1036893878 8:12615122-12615144 CAAAATGCTGATGGTTATATGGG - Intergenic
1037183847 8:16038130-16038152 TAAAATGCTGTTTATCATTTAGG - Intergenic
1037596726 8:20360550-20360572 CAATCTGCTGATAATGGTCTTGG + Intergenic
1038880541 8:31606076-31606098 CAAAATGCTGATAGTAATAAGGG - Intergenic
1039315250 8:36364586-36364608 TAAAATGCAGATTCTGATTTCGG - Intergenic
1039652306 8:39354791-39354813 CAAAATGCTGATGAGGCTGTGGG + Intergenic
1040540120 8:48346346-48346368 CAAAATGCTGATGGTGATAGGGG + Intergenic
1040774004 8:51016695-51016717 AAAAATGCTAATAATCATGTGGG + Intergenic
1040994002 8:53382684-53382706 TAAAATGCTTACAATGTTTTTGG + Intergenic
1041149407 8:54915709-54915731 CACAATGCTGACAGTTATTTTGG - Intergenic
1041255001 8:55972365-55972387 CAAGAAGCAGATAATGATTAAGG - Intronic
1043694665 8:83203887-83203909 CAAAATGCTGATGGTGATATGGG + Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044127104 8:88472209-88472231 CAAAATGCTGAGAGTGATATGGG - Intergenic
1044690430 8:94871486-94871508 AAAAATGATAATAATAATTTGGG + Intronic
1044906277 8:97007152-97007174 CAGAATGCTGTTAAAGATGTCGG - Intronic
1045120748 8:99031656-99031678 GAAAATGCTGATATTGATGACGG - Intronic
1045730431 8:105232663-105232685 CCAAATGCTGGCAATGATATGGG - Intronic
1045849198 8:106673177-106673199 CAAAATGCTGATAGTGATAATGG + Intronic
1046123868 8:109880079-109880101 CCAAAAGATGATTATGATTTGGG - Intergenic
1046130524 8:109962348-109962370 CAAAATGCTGTTGATGAATCTGG + Intergenic
1046134129 8:110004471-110004493 CAAAATGCTGATAGTGATGTGGG - Intergenic
1046151855 8:110237727-110237749 CTAAATGCTGGTAAGGATGTGGG - Intergenic
1046571603 8:115973137-115973159 AAAAGTGCTGATAATCATATAGG + Intergenic
1046668917 8:117036246-117036268 CAAAATGCTGACAGTGATATGGG - Intronic
1046842659 8:118877290-118877312 CAAAATGAAGATAATGAATGAGG + Intergenic
1047527288 8:125644414-125644436 CAAAATGACGATAATAATTCTGG - Intergenic
1048699932 8:137077441-137077463 CAAAATGTTGATAATGATATGGG + Intergenic
1048726231 8:137388068-137388090 CACAATGCTGATAGTGATATGGG - Intergenic
1048806452 8:138245905-138245927 CAAATTGCTGATAGTGATATGGG + Intronic
1050088884 9:1995694-1995716 CAAGAGCCTAATAATGATTTTGG + Intergenic
1050660210 9:7876197-7876219 CAAAATGCTTATAGTAATATGGG + Intronic
1050890625 9:10819845-10819867 AAAAATGCTGAGAGTGATATGGG - Intergenic
1050897368 9:10900201-10900223 CAAAATGATGATAGTGATATGGG - Intergenic
1051569089 9:18535343-18535365 CAAAATGCTGATAGTGATACAGG - Intronic
1052220715 9:26018288-26018310 TAAAATGCTGATAATGATATGGG - Intergenic
1052514912 9:29467844-29467866 CAAACTGCTAATAAAAATTTAGG - Intergenic
1052530356 9:29675251-29675273 CAAAGTGCTGACAAAGATTTTGG + Intergenic
1052635430 9:31097742-31097764 CCAAATGCTGACAATGATATAGG + Intergenic
1053086586 9:35229069-35229091 TCAAATGTTGATAAGGATTTGGG - Intronic
1054833057 9:69647428-69647450 CAAAATGCTGATAAACTCTTAGG - Intronic
1055174510 9:73300395-73300417 CAAAATGCTGATAATGATACGGG - Intergenic
1055211182 9:73794921-73794943 AAAAATGCAGATTATGCTTTTGG - Intergenic
1055213051 9:73822030-73822052 CAAATTGTTTATAATGATTCGGG - Intergenic
1056331734 9:85526702-85526724 CAACATGCTGAACTTGATTTTGG + Intergenic
1056878278 9:90360335-90360357 CAAAATTCCAAAAATGATTTTGG - Intergenic
1057285435 9:93749742-93749764 CAAACTGCTGATAGTGATATGGG - Intergenic
1058722156 9:107773933-107773955 CAAAATGCTGACAGTTATATGGG - Intergenic
1059570175 9:115425833-115425855 CTAACTGCTGATAATGATATGGG - Intergenic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059582435 9:115566408-115566430 CAAAATGCTGATAATGATACAGG + Intergenic
1059969440 9:119650041-119650063 TAAAATGGTTATTATGATTTTGG + Intergenic
1060033570 9:120235864-120235886 CAACATGATGATAATGATGGTGG - Intergenic
1060244909 9:121936990-121937012 CAAAATGCAGACAAGGATTTTGG + Intronic
1060451667 9:123748265-123748287 CACCATGCTGATAATGACTAAGG - Intronic
1060523071 9:124305180-124305202 GAAGATTCTGATAAAGATTTTGG - Intronic
1202790032 9_KI270719v1_random:79164-79186 CAAAATCCTTAGTATGATTTTGG + Intergenic
1203635517 Un_KI270750v1:106856-106878 CAAAATGCTGATAATGATATGGG - Intergenic
1203656406 Un_KI270753v1:1990-2012 CAAAATAATGTAAATGATTTGGG - Intergenic
1186126047 X:6414970-6414992 CAAAATGTTGTTATTGAATTTGG - Intergenic
1186131656 X:6473224-6473246 GTAAATGATGATAATGATTATGG + Intergenic
1186842361 X:13496495-13496517 CAAAAAGCTGATTACAATTTTGG - Intergenic
1187742276 X:22368854-22368876 CAATTTGCTGATGATGACTTCGG + Intergenic
1188001004 X:24981671-24981693 CTAAATACAGGTAATGATTTAGG - Intronic
1188053064 X:25510192-25510214 CAAAATGCTGATAATGATAATGG - Intergenic
1188649842 X:32618762-32618784 ATAAATGTTGATAACGATTTAGG + Intronic
1188749163 X:33884559-33884581 CAAAATGCTGATGGTTATATGGG + Intergenic
1189071390 X:37867288-37867310 CAGAATGCTGATAGTGATATGGG - Intronic
1189245402 X:39559781-39559803 TAACATGGGGATAATGATTTTGG - Intergenic
1189637292 X:43024275-43024297 CAAAATGCTGATAATGATATGGG - Intergenic
1190822894 X:53990886-53990908 GAAGATGGTGATAATGATGTGGG - Intronic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1191760806 X:64646452-64646474 CAAAATGTTGATAGTAATATGGG + Intergenic
1192104439 X:68300361-68300383 CAAAATGCTAATAAAATTTTTGG - Intronic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192866881 X:75143376-75143398 CAAAATGCTGATAATGATAATGG - Intronic
1192934990 X:75849954-75849976 AAAAATGCTGATAATGATATGGG - Intergenic
1193248746 X:79263082-79263104 CAAAATTGTTATAATAATTTTGG - Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1193628088 X:83844291-83844313 CTAAATGCTGATAAAAATATGGG - Intergenic
1193945819 X:87732873-87732895 CAAAATGACAATAATGCTTTGGG + Intergenic
1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG + Intergenic
1194093148 X:89602742-89602764 CAAAATGTTGATAGTGGGTTGGG + Intergenic
1194430302 X:93795264-93795286 CAAAATGGTTGTAATGACTTGGG - Intergenic
1194464570 X:94217627-94217649 TAAAATCCTGATAAAAATTTGGG + Intergenic
1194947286 X:100084147-100084169 GGAAATCCTGATACTGATTTTGG + Intergenic
1195282189 X:103347464-103347486 CATAATGGTGATAATGAATGAGG + Intergenic
1195338111 X:103877260-103877282 TACAATGCTTATAAAGATTTGGG + Intergenic
1195476611 X:105293510-105293532 AAAACTGCTGACAAAGATTTGGG - Intronic
1196028954 X:111074781-111074803 CAAAATGCTGATGGAGATGTGGG + Intronic
1196049424 X:111289350-111289372 TAAAATGCAGACTATGATTTTGG - Intergenic
1197385343 X:125795037-125795059 CAAAATGCTGATAGTAATATGGG + Intergenic
1198285019 X:135180768-135180790 GTAAATGTTGAGAATGATTTGGG - Intergenic
1198569189 X:137937314-137937336 CAAAATGCTGATAGAAATATGGG + Intergenic
1198588470 X:138149197-138149219 CAAAATGCTGATAGAAATATGGG + Intergenic
1198733507 X:139760300-139760322 GAAAATGATGATAATGATGATGG - Intronic
1198923002 X:141751457-141751479 CAATATGCAGAAAATAATTTGGG + Intergenic
1199264195 X:145811122-145811144 CAAAATGCTGATGATTATTTTGG - Intergenic
1199388998 X:147257723-147257745 CAAAATGCTGATAAGAAGTTGGG + Intergenic
1199413996 X:147558714-147558736 TAAAATGCTGATACTTATCTAGG + Intergenic
1199472433 X:148209835-148209857 CAAAATACTGATAGTTATTATGG + Intergenic
1199727284 X:150596787-150596809 CCAAAGACTGAGAATGATTTAGG + Intronic
1200445779 Y:3258845-3258867 CAAAATGTTGATAGTGGGTTGGG + Intergenic
1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG + Intergenic
1201738295 Y:17295685-17295707 CCAAATCCTGCTAATGTTTTGGG + Intergenic