ID: 1012577209

View in Genome Browser
Species Human (GRCh38)
Location 6:100817860-100817882
Sequence CTCTTTTTGTAACGAGTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 94}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012577209_1012577210 5 Left 1012577209 6:100817860-100817882 CCTCACACTCGTTACAAAAAGAG 0: 1
1: 0
2: 0
3: 8
4: 94
Right 1012577210 6:100817888-100817910 AACACTTCCCGATTCATTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012577209 Original CRISPR CTCTTTTTGTAACGAGTGTG AGG (reversed) Intronic
900537102 1:3184291-3184313 ATCTGTTTGCAACCAGTGTGAGG + Intronic
901272534 1:7963675-7963697 CTCTTTAAGAAACGAGTCTGAGG - Intronic
901884035 1:12210231-12210253 CTCTTTATGGAATAAGTGTGGGG - Intergenic
904780705 1:32945018-32945040 TTCCTTTTGTAAGGATTGTGAGG + Intronic
904873290 1:33635151-33635173 CTCATTTTGGAATGAGGGTGAGG + Intronic
904964136 1:34358654-34358676 CTCTTTTTTTACTCAGTGTGGGG + Intergenic
906581791 1:46941132-46941154 CTTGTTTTGTAACAAATGTGAGG - Intronic
907429403 1:54403452-54403474 CTGTTTTTGGAGGGAGTGTGTGG - Intronic
907739990 1:57156169-57156191 ATCTTTTTGGAAGCAGTGTGGGG - Intronic
908412274 1:63878756-63878778 CTCTTTTTATAAGTACTGTGAGG + Intronic
909462068 1:75928191-75928213 CTATTTTTGTACCTAGAGTGTGG + Intronic
912686001 1:111765484-111765506 CTCTTTTTCTAGTGAGAGTGAGG + Intronic
914793557 1:150900768-150900790 CTCTTTTTCTATTGAATGTGTGG - Intergenic
917452184 1:175156393-175156415 CTCTGGTTGTCATGAGTGTGTGG + Intergenic
919209201 1:194456809-194456831 CTCTTTTTCTTACGAGTCTTGGG - Intergenic
920520730 1:206623612-206623634 TACTTTTTGTAAACAGTGTGAGG + Intergenic
923591696 1:235326661-235326683 CTCTTTTTGTAGGGAATGAGAGG - Intronic
923879881 1:238091960-238091982 CTCTATTTGTTAAGACTGTGGGG + Intergenic
1066332738 10:34442553-34442575 CTTTTTTTTTAACGAATGTGAGG - Intronic
1066927606 10:41717459-41717481 CTCTTTTTGTAGTATGTGTGAGG + Intergenic
1071341867 10:84656799-84656821 CTCCTTTTGAAATGACTGTGTGG - Intergenic
1071749364 10:88457282-88457304 TTGTTTTTGTAAAGAGTTTGGGG + Intronic
1078318877 11:10315618-10315640 TTCTTTTTGTAGAGAGAGTGTGG + Intronic
1082313673 11:50689725-50689747 CTCTTTTTGTAGAATGTGTGAGG + Intergenic
1086231597 11:84577188-84577210 CTCTTTTTGTTCCCAGTTTGGGG + Intronic
1093985932 12:25533366-25533388 CTCTATTTGTAAAGAGATTGAGG + Intronic
1096937305 12:55295629-55295651 GTCTTTTTATAACGAGTATGAGG + Intergenic
1097180000 12:57166380-57166402 TTTTTTTTGTAAAGAGTGGGAGG - Intronic
1100180481 12:92080174-92080196 GGCTGTTTGTAACAAGTGTGTGG - Intronic
1100812767 12:98356222-98356244 CTCATTTTGTAAGGACTCTGAGG - Intergenic
1106121134 13:26860951-26860973 CTCTTTTTCTTCCCAGTGTGGGG - Intergenic
1108051041 13:46439337-46439359 TTCCTTTTGTAACAAGTGTGTGG + Intergenic
1109543602 13:63812957-63812979 TTCCTTTTGTAACAAGTGTGTGG + Intergenic
1117036712 14:51737843-51737865 CTCTTTTTCTAAAAAGTCTGTGG - Intergenic
1120500044 14:85285410-85285432 CTATTTTAGTAACCAGTTTGTGG - Intergenic
1124466842 15:29947922-29947944 CTCTTGTAGCAAGGAGTGTGGGG - Intronic
1125300492 15:38249905-38249927 CCCTTTATGTAAGCAGTGTGTGG + Intergenic
1126336183 15:47588483-47588505 CTCTTTTTTTACGGAGTCTGAGG - Intronic
1127578771 15:60317663-60317685 CTCTTTTTGTTACCAGTTTTGGG - Intergenic
1130434694 15:83886083-83886105 CTGCTTTTGTAGCGTGTGTGTGG - Intronic
1133561637 16:6956011-6956033 CACTTTTTGTAATGAGGGTGAGG + Intronic
1134405255 16:13952499-13952521 GTCAGTTTGTAATGAGTGTGTGG + Intergenic
1137365916 16:47859328-47859350 CTCTGACTGTAAGGAGTGTGGGG + Intergenic
1140863133 16:79036653-79036675 CTGTTTTTGGAAGGACTGTGAGG + Intronic
1149944142 17:60903090-60903112 CTCTTTTTTTCATGTGTGTGAGG + Intronic
1155099683 18:22597666-22597688 CTCTTTTTTGAATGAGTTTGTGG + Intergenic
1160236672 18:77091034-77091056 CTCTTTTAGGAATGAGTTTGAGG - Intronic
1166173777 19:41050947-41050969 CTTTTTTTGTCACCAGTGTCTGG - Intergenic
1167401214 19:49271376-49271398 ATCTTTTTGGCACTAGTGTGGGG - Intergenic
927371664 2:22363009-22363031 CTCCTTTTGTAAAGTGTCTGTGG + Intergenic
929303429 2:40332401-40332423 CTCTTTCTGCAACATGTGTGTGG + Intronic
929809099 2:45173599-45173621 CCCTTCTTGTAATGACTGTGTGG - Intergenic
929850591 2:45585452-45585474 CTCTTTATTTAGCGAGTGTATGG - Intronic
934982835 2:98860596-98860618 ATTTTTATGTAACCAGTGTGAGG - Intronic
935737602 2:106118656-106118678 CTCTTTTTCTAAGGGGTGTGTGG + Intronic
937926199 2:127169368-127169390 CTATCTTTGTAACAAGTATGTGG - Intergenic
940548581 2:155121870-155121892 CTGTTTTTGTAAAAAGTGTGTGG + Intergenic
1171148148 20:22803688-22803710 CTCTTTTCTTCATGAGTGTGTGG - Intergenic
1177242364 21:18475623-18475645 CTCTTTTTGAAATGACTGGGAGG - Intronic
1178547668 21:33506440-33506462 CTCTTTTTTTAAAAAGTGTGAGG - Intronic
1181724694 22:24803820-24803842 CTGTTTGTTTAACAAGTGTGTGG - Intergenic
1183442752 22:37832540-37832562 CTCTTTCTGATACGAGTGTCTGG + Intronic
950426458 3:12927198-12927220 TTCTTTTTGTTAACAGTGTGTGG - Intronic
954249071 3:49354342-49354364 CTTTTTTTTTAACTAGTGTAAGG + Intergenic
955512244 3:59693004-59693026 CTATTTTTGTAAATGGTGTGAGG - Intergenic
957223744 3:77416002-77416024 CTCTTTTTGTACCTACTGTTTGG + Intronic
958103154 3:89039267-89039289 CTCTTTTTGTTGAGTGTGTGGGG - Intergenic
963469770 3:145725676-145725698 TTCTTTTTGCAAAGAGTGTCTGG - Intergenic
965083206 3:164062849-164062871 CCCTTTTTGTAGAGATTGTGGGG + Intergenic
966120543 3:176514611-176514633 CTCTTTGTGTGTCGAATGTGTGG - Intergenic
967141102 3:186561396-186561418 ATCTTTTGTTAACAAGTGTGAGG - Intronic
976430581 4:84959363-84959385 TTCATTTTGGAAAGAGTGTGAGG + Intronic
976955141 4:90887263-90887285 CTATTTTTGAGAAGAGTGTGGGG + Intronic
980906757 4:138955770-138955792 GTCTTTTTGTGACGAGTTTATGG + Intergenic
981242707 4:142497216-142497238 CTCTGGTTGTAACTAATGTGAGG + Intronic
985292893 4:188404619-188404641 CTTTTTTTGGAAGGAGGGTGGGG + Intergenic
985966013 5:3339210-3339232 CTCTTTGTGCACCGTGTGTGGGG - Intergenic
988450078 5:31333039-31333061 CTCATTTTGTGACGGGTGAGAGG - Intergenic
990704479 5:58513055-58513077 CTCTTTTTGTTCCCAGTTTGGGG + Intergenic
992294968 5:75318653-75318675 CTCTTTTTGTAACAAGTTGTTGG - Intergenic
994588282 5:101739675-101739697 CTCTTCTTTTAAAGAGTGTAGGG + Intergenic
996464641 5:123785626-123785648 CTATTTTTGGAACCACTGTGAGG + Intergenic
1002483113 5:179516577-179516599 CTCTGTGTGTAAAGATTGTGGGG - Intergenic
1004589194 6:17032126-17032148 CTCTTTTTGTAATCAGAGGGGGG + Intergenic
1005478593 6:26233653-26233675 CTGTATTTGTAAATAGTGTGGGG - Intergenic
1012577209 6:100817860-100817882 CTCTTTTTGTAACGAGTGTGAGG - Intronic
1012826480 6:104152536-104152558 CTCTTTTTGTTACCAGTTTCAGG - Intergenic
1014770926 6:125457593-125457615 CTCTTTTTGTTCCCAGTGTTGGG - Intergenic
1017378643 6:153800811-153800833 AGCTTTGTGTATCGAGTGTGAGG + Intergenic
1024377376 7:48655331-48655353 CTTTTTATGTTACAAGTGTGTGG + Intergenic
1034134479 7:148753425-148753447 CTCTCTTTCTCAGGAGTGTGTGG + Intronic
1040112765 8:43577607-43577629 CTCTTTTTGTAAAACCTGTGAGG + Intergenic
1040114376 8:43598731-43598753 CTCTTTTTGTAAAATCTGTGAGG + Intergenic
1040115347 8:43611609-43611631 CTCTTTTTGTAGCATCTGTGAGG + Intergenic
1045498816 8:102729670-102729692 CTCTTTTTCTAGCCAGGGTGGGG + Intergenic
1050575505 9:6990950-6990972 ATCCTTTTGTAACTGGTGTGGGG + Intronic
1051345283 9:16145678-16145700 CTCTTCCTGTAACCAGTCTGTGG - Intergenic
1052136372 9:24916430-24916452 TTGTTTTTGTAAATAGTGTGAGG + Intergenic
1052257210 9:26471946-26471968 CTATCTTTGAAAGGAGTGTGTGG + Intergenic
1055720732 9:79171193-79171215 GTCATTTTGTACTGAGTGTGAGG + Intergenic
1188976030 X:36676733-36676755 CTCTTTTTCTAACCAGTCTCGGG - Intergenic
1195860644 X:109379682-109379704 CTATTTTTCTGACAAGTGTGGGG - Intronic
1197400216 X:125980347-125980369 CTCTTTTTGTTACCAGTTTTGGG - Intergenic