ID: 1012578417

View in Genome Browser
Species Human (GRCh38)
Location 6:100831608-100831630
Sequence GGCCCCAGGAATCATTTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 212}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012578417_1012578428 28 Left 1012578417 6:100831608-100831630 CCATCAAAATGATTCCTGGGGCC 0: 1
1: 0
2: 1
3: 25
4: 212
Right 1012578428 6:100831659-100831681 AGTAAGGAGGAATGTGAAGGGGG No data
1012578417_1012578420 -1 Left 1012578417 6:100831608-100831630 CCATCAAAATGATTCCTGGGGCC 0: 1
1: 0
2: 1
3: 25
4: 212
Right 1012578420 6:100831630-100831652 CACAGCTACTATAGAAATTTAGG No data
1012578417_1012578424 15 Left 1012578417 6:100831608-100831630 CCATCAAAATGATTCCTGGGGCC 0: 1
1: 0
2: 1
3: 25
4: 212
Right 1012578424 6:100831646-100831668 ATTTAGGGCATGGAGTAAGGAGG 0: 1
1: 0
2: 1
3: 17
4: 185
1012578417_1012578422 5 Left 1012578417 6:100831608-100831630 CCATCAAAATGATTCCTGGGGCC 0: 1
1: 0
2: 1
3: 25
4: 212
Right 1012578422 6:100831636-100831658 TACTATAGAAATTTAGGGCATGG 0: 1
1: 0
2: 2
3: 22
4: 249
1012578417_1012578425 25 Left 1012578417 6:100831608-100831630 CCATCAAAATGATTCCTGGGGCC 0: 1
1: 0
2: 1
3: 25
4: 212
Right 1012578425 6:100831656-100831678 TGGAGTAAGGAGGAATGTGAAGG 0: 1
1: 0
2: 2
3: 44
4: 483
1012578417_1012578421 0 Left 1012578417 6:100831608-100831630 CCATCAAAATGATTCCTGGGGCC 0: 1
1: 0
2: 1
3: 25
4: 212
Right 1012578421 6:100831631-100831653 ACAGCTACTATAGAAATTTAGGG No data
1012578417_1012578427 27 Left 1012578417 6:100831608-100831630 CCATCAAAATGATTCCTGGGGCC 0: 1
1: 0
2: 1
3: 25
4: 212
Right 1012578427 6:100831658-100831680 GAGTAAGGAGGAATGTGAAGGGG No data
1012578417_1012578423 12 Left 1012578417 6:100831608-100831630 CCATCAAAATGATTCCTGGGGCC 0: 1
1: 0
2: 1
3: 25
4: 212
Right 1012578423 6:100831643-100831665 GAAATTTAGGGCATGGAGTAAGG 0: 1
1: 0
2: 4
3: 13
4: 168
1012578417_1012578426 26 Left 1012578417 6:100831608-100831630 CCATCAAAATGATTCCTGGGGCC 0: 1
1: 0
2: 1
3: 25
4: 212
Right 1012578426 6:100831657-100831679 GGAGTAAGGAGGAATGTGAAGGG 0: 1
1: 0
2: 2
3: 54
4: 520

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012578417 Original CRISPR GGCCCCAGGAATCATTTTGA TGG (reversed) Intronic
902810168 1:18883535-18883557 GGGACCAGGAAACATTTGGAGGG + Intronic
903032800 1:20475835-20475857 AGCCCTAGGAATCATGTTTATGG - Intergenic
904909578 1:33923911-33923933 GGCACCAGGAACCAATTTCATGG - Intronic
907481148 1:54746356-54746378 GGCACCAGGGATCAATTTGGTGG - Intergenic
907673840 1:56500648-56500670 GGCCCTAGGAATCATTGTCAAGG + Intronic
909131296 1:71740537-71740559 GGCCCCAGGAAACATCTTTGTGG - Intronic
913579441 1:120211128-120211150 GGTACCAGGAACCATTTTCAAGG - Intergenic
913628731 1:120687260-120687282 GGTACCAGGAACCATTTTCAAGG + Intergenic
914561376 1:148822555-148822577 GGTACCAGGAACCATTTTCAAGG - Intronic
914611459 1:149307653-149307675 GGTACCAGGAACCATTTTCAAGG + Intergenic
915590960 1:156869980-156870002 GGCCCCTGGAACCATGTTGAGGG + Intronic
916563756 1:165955421-165955443 GGCCCCAAAGATCATTTTGCTGG - Intergenic
918679693 1:187336987-187337009 GGTTCCAGAAATCATTTTCAGGG - Intergenic
922137047 1:222839381-222839403 GGCACCAGGAACCAATTTCATGG - Intergenic
922918866 1:229283641-229283663 GGCCCAAGGAATGATTTGGAAGG - Intronic
923076780 1:230616626-230616648 TGACCCAGGTATCATTTTGTAGG + Intergenic
1066245384 10:33578373-33578395 GGCCACAAGCATCATTTTTATGG + Intergenic
1069814284 10:71183886-71183908 GGAGCCAGGAATCACTTTGAAGG - Intergenic
1071117839 10:82244634-82244656 GGCACCAGGGATCATTTTTGTGG + Intronic
1071750975 10:88475382-88475404 AGCCCCAGGAAGAATTTTTAGGG - Intronic
1073232363 10:101982980-101983002 GGCACCAGGAACCAGTTTCATGG - Intronic
1074401103 10:113141662-113141684 GGATGCAGGAATCATATTGAAGG + Intronic
1074735296 10:116425009-116425031 GGCACCAGGGATCAGTTTTATGG - Intergenic
1074819333 10:117166977-117166999 GCCCCCAGGAATCAGCTTGTAGG + Intergenic
1075138101 10:119805023-119805045 GGCCCAGTGAATCATTTTGATGG + Intronic
1075728434 10:124622566-124622588 GGCCCAAGGAACGATTTGGAGGG - Exonic
1075867830 10:125742115-125742137 GCCCCAAGGAATCATTCAGAAGG - Intronic
1076083091 10:127600883-127600905 TGCCTCAGGAATCATTACGAGGG + Intergenic
1076673912 10:132137844-132137866 GGCCCCTGGACGCATTTAGAAGG + Intronic
1080920296 11:36702013-36702035 GGCCCCAGCAAACATGTTGCTGG - Intergenic
1084984856 11:72859934-72859956 GGCACCAGGAACCAGTTTCATGG + Intronic
1085820438 11:79787544-79787566 GGCACAAGGAAACTTTTTGAAGG + Intergenic
1086009726 11:82085924-82085946 GGCACCAGGGATCAGTTTCATGG - Intergenic
1090330503 11:125927713-125927735 GGCCTCAGGCATGATTTAGAAGG + Intergenic
1091094847 11:132810752-132810774 GCCCAGAGGAAACATTTTGAAGG - Intronic
1091643745 12:2257356-2257378 GGCACCAGGAATCAGTTTCGTGG + Intronic
1091942276 12:4498685-4498707 GGCACCAGGAACCAGTTTCACGG + Intronic
1092292117 12:7166629-7166651 GGCACCAGGGATCAGTTTCATGG - Intergenic
1092897255 12:13024192-13024214 GGTCACAGGAACCAATTTGAAGG - Intergenic
1094796802 12:33983382-33983404 GGCACCAGGAAACATTTGGAAGG + Intergenic
1095109354 12:38275368-38275390 GGCACCAGGAAAAATTTGGAAGG + Intergenic
1097973881 12:65664323-65664345 GGCACCAGGAACCAGTTTCATGG + Intergenic
1101857117 12:108453079-108453101 GGCCACAGGAATCTTTGTGGAGG + Intergenic
1102140812 12:110613637-110613659 GGACCCAGGAATCAGTTTTTGGG - Intergenic
1104492133 12:129203487-129203509 GGTCCCAGGAAGCATGTGGAGGG + Intronic
1104538530 12:129641171-129641193 GGCACCAGGAACCAGTTTTATGG - Intronic
1106663871 13:31831428-31831450 GGCCTCAATAGTCATTTTGAAGG - Intergenic
1111681135 13:91443122-91443144 GGCCACTGCAAACATTTTGAGGG + Intronic
1111935539 13:94553453-94553475 GGACCTAGGAACCAGTTTGAAGG + Intergenic
1112053169 13:95664362-95664384 GGCACCAGGAATCAGTTTCGTGG + Intergenic
1112407283 13:99132442-99132464 GTCTCCAGGAAGCAGTTTGAAGG + Intergenic
1113013100 13:105793416-105793438 GGCCTCAGGAAACATATTCATGG + Intergenic
1114025589 14:18523185-18523207 GTCCCCAGGAATCATTTGGGAGG - Intergenic
1114220535 14:20692685-20692707 GGCACCAGGGATCATTTTTGTGG - Intronic
1114674880 14:24433050-24433072 GGCCCCAGGCTTGATATTGAAGG + Intronic
1115457280 14:33618162-33618184 GGCACCAGGAACCAGTTTCATGG + Intronic
1116031893 14:39583607-39583629 GGCACCAGGAACCATTTTCGTGG - Intergenic
1117132298 14:52697992-52698014 GGCCCCAGTTATCCTTTTTAGGG + Intergenic
1117642066 14:57810483-57810505 GGTGTCAGGAATAATTTTGAGGG - Intronic
1119272005 14:73314545-73314567 GACCTCAGGATTGATTTTGAGGG + Intronic
1120924334 14:89782755-89782777 GGCACCAGGGATCAGTTTGATGG + Intergenic
1121149218 14:91615394-91615416 GGCACCAGGAACCAGTTTCATGG - Intronic
1124657155 15:31517813-31517835 GGCCCCAGGGAACAGTTTGGGGG + Intronic
1125446397 15:39762274-39762296 GACCCAAGGAATCATTCGGAAGG - Intronic
1126510039 15:49460484-49460506 GGTACCAGGATTCTTTTTGAAGG + Intronic
1126798403 15:52279003-52279025 TTCCCCAGGAATCATTTTGGTGG - Exonic
1126821699 15:52510769-52510791 GGCCCCAGGGACCAGTTTCATGG - Intronic
1127282624 15:57504873-57504895 GGCCCCATGAATCACTGTGAGGG - Intronic
1127357690 15:58216731-58216753 GGATACAGGATTCATTTTGAAGG - Intronic
1128347408 15:66863249-66863271 GGCCCCAGGAAGCTTTTAGCAGG - Intergenic
1129863766 15:78886322-78886344 GGTACCAGGAATCATTTTATAGG - Intronic
1130858628 15:87865386-87865408 GGCCTCAGGATTCATTATCAAGG + Intronic
1131064649 15:89426437-89426459 GGCCTCATGAATGGTTTTGATGG + Intergenic
1131937683 15:97524555-97524577 GCCACCAGGAATCTTTTTGGAGG - Intergenic
1132033303 15:98457084-98457106 GGCACCAGGAACCAGTTTCATGG + Intronic
1132067401 15:98743625-98743647 GGCCCCAGAAGCCATGTTGAGGG + Intronic
1132639901 16:973054-973076 GGCTCCTGGATTCTTTTTGATGG - Intronic
1134544716 16:15098977-15098999 GGCACCAAGAAGCTTTTTGAAGG + Intronic
1135042217 16:19126401-19126423 GGCACCAGGAACCAGTTTCATGG - Intronic
1136079584 16:27842903-27842925 GTCCCCAGGAAGAATTTTGAAGG - Intronic
1137271139 16:46902948-46902970 GGCCCAAGAAATAATTTTAAAGG - Intronic
1140977556 16:80074740-80074762 GGCCTCTGGAGGCATTTTGATGG - Intergenic
1141270326 16:82533957-82533979 GTCCCAAGCAAGCATTTTGAGGG + Intergenic
1141300186 16:82807814-82807836 GTCCCCAGTAATTATTTTTATGG - Intronic
1141352442 16:83310664-83310686 AGCACCAGGGTTCATTTTGATGG - Intronic
1141929704 16:87193965-87193987 GGCACCAGGGATCAGTTTCATGG + Intronic
1142088504 16:88197621-88197643 GGCCCCAGGAACCATGGGGAGGG - Intergenic
1142470715 17:161848-161870 GGCCCCAGGAAGCACCTTCAGGG + Intronic
1144297379 17:13888968-13888990 GGGCCCAGGAATCTTTTTGTTGG + Intergenic
1146529963 17:33600106-33600128 AGCCACAGGAATCCTTTTCATGG + Intronic
1147862995 17:43534533-43534555 GGCCCCAGAAAACACTTTCAAGG + Intronic
1150204722 17:63394319-63394341 GGACACAGGAATCAGTTTGAAGG - Intronic
1152029450 17:77832756-77832778 GGCACCAGGGATCATTTTCGTGG - Intergenic
1155908295 18:31478766-31478788 GGCACCAGGAATCACTTTTGTGG + Intergenic
1156577433 18:38334297-38334319 GGCACCAGGCACCACTTTGATGG - Intergenic
1157089767 18:44623881-44623903 GGTCCCTGGGATAATTTTGAAGG - Intergenic
1157715561 18:49884257-49884279 GGCACCAGAGATCAGTTTGATGG + Intronic
1159295015 18:66473942-66473964 GGTCTCAGTATTCATTTTGATGG + Intergenic
1160380971 18:78455413-78455435 GGCCCCAGGAAGGGTTGTGAGGG + Intergenic
1162335030 19:10055050-10055072 GGGCTCAGGAATGACTTTGAGGG - Intergenic
1164524072 19:29000664-29000686 GGCCCGGGGAAGCATTTTGCAGG - Intergenic
1164593269 19:29517743-29517765 GGCCCCAGGACCCATTCTCAGGG + Intergenic
1165252082 19:34547013-34547035 GGCACCAGGGATCAGTTTCATGG - Intergenic
1167789488 19:51664446-51664468 GGGCTCAGTACTCATTTTGATGG - Intergenic
1168507957 19:56952079-56952101 GGCACCAGGGATCAGTTTGGTGG + Intergenic
927673939 2:25091031-25091053 GGCCACAGGGAGCATTTTGAGGG - Intronic
927956477 2:27211146-27211168 GGCCCCAGGACAGATTTTGAGGG - Intronic
929017455 2:37513107-37513129 GGGCCCAGGGATGATGTTGAAGG + Intergenic
929058182 2:37896889-37896911 GGCACCAGGGATCAGTTTCATGG + Intergenic
929596187 2:43177847-43177869 TGGCCCAGGAAGCTTTTTGAGGG + Intergenic
931489039 2:62724943-62724965 GGCACCAGGAACCAATTTCATGG - Intronic
932718321 2:74119948-74119970 GGCCACAGGAATAAGTTTGAAGG - Intergenic
935018973 2:99212242-99212264 GGCACCAGGAACCAGTTTCATGG + Intronic
935598807 2:104901378-104901400 GGCCTAATGAATCAATTTGAGGG + Intergenic
936414027 2:112287898-112287920 GGCCGTTGGAAACATTTTGAAGG + Intronic
936632617 2:114220206-114220228 AGCCCCAGTAAACATTTTGATGG - Intergenic
936988380 2:118334211-118334233 AGCCCCAGTCAACATTTTGATGG + Intergenic
937557543 2:123177374-123177396 GTCCCCATGACTCATATTGAAGG + Intergenic
938652163 2:133394672-133394694 AACCCCAGGAACCATTTTGTTGG + Intronic
939824212 2:146995333-146995355 TGCCCATGGAATCATTATGACGG + Intergenic
941051026 2:160734425-160734447 GGACACAGGAACCATTTTAAAGG - Intergenic
942251340 2:174049714-174049736 TGCCCATGGAATCATTTTGTGGG + Intergenic
942508331 2:176668161-176668183 GGCAGAAGGAATCATTTTCAAGG - Intergenic
945980546 2:216307117-216307139 GGCCCCAGGAACCACCTGGAAGG + Intronic
947321338 2:228922529-228922551 GGCACCAGGAAGCAGTTTCATGG + Intronic
947653596 2:231808012-231808034 GCCCCCAGGGATGATTGTGAAGG + Exonic
948788851 2:240366668-240366690 GGCCGCAGGGATCATCTGGAAGG + Intergenic
1169938542 20:10912064-10912086 GATCCCAGGAAGCATATTGAAGG + Intergenic
1172149517 20:32780201-32780223 GGCCCCAGGATGCATTCTTAGGG - Intronic
1175057800 20:56213977-56213999 GGCCTCAGGAAACACTGTGAGGG + Intergenic
1177652210 21:23972010-23972032 GGCCCCAGGATTTTCTTTGATGG + Intergenic
1179256411 21:39720071-39720093 GACACCAGGAATCATTTTCATGG + Intergenic
1179489065 21:41728474-41728496 GGGTCCAGAAATCACTTTGAGGG + Intergenic
1180061047 21:45385244-45385266 GGCCGCAGGAGTCATTCTGGGGG + Intergenic
1180449774 22:15450810-15450832 GTGCCCAGGAATCATTTGGGAGG - Intergenic
1182449501 22:30410596-30410618 GGCCACAGGAAACAGTTTGGGGG - Exonic
1183226417 22:36553266-36553288 GGCACCAGGGATCAGTTTCATGG + Intergenic
1183479310 22:38054365-38054387 GGGACCAGGAATCTATTTGAGGG - Intergenic
1184296295 22:43527526-43527548 GACCCCAGGAAACATTTTCCAGG + Intergenic
949705102 3:6807521-6807543 GGTCCCAGGAAACATTTAAAAGG - Intronic
953161693 3:40426401-40426423 GGCCACAGATATCATTTTTAAGG + Intronic
953940126 3:47087294-47087316 GGCACCAGGAACCAGTTTCAGGG + Intronic
956838200 3:73112875-73112897 GGCCCCAAGAAACATTTTTAGGG - Intergenic
960845512 3:122001139-122001161 CTCCCCAGGCATCATTTTCAGGG + Intronic
962985143 3:140529345-140529367 GGCCTCAGGCATCATTCTGGGGG + Intronic
967322203 3:188205802-188205824 GACTCCAGGAGTCATCTTGAGGG + Intronic
967597556 3:191345031-191345053 GAGCCCAGGAATCAATTTGATGG + Intronic
968735124 4:2291343-2291365 GGCTCCAGGAAGCATTCTCAAGG - Intronic
969073509 4:4558673-4558695 GGCACCAGGAGTAACTTTGAGGG - Intergenic
969540645 4:7787001-7787023 GGCCCGAGAAATCCTTTAGAAGG + Intronic
970193157 4:13533777-13533799 GGCGCCAGGAAAAATTCTGAGGG + Intergenic
971316906 4:25575082-25575104 GGTCCCAGGCATTATTTAGATGG - Intergenic
972675080 4:41252287-41252309 GGCCCCAGGGACCAGTTTCATGG + Intergenic
973037598 4:45425815-45425837 GGCACCAGGGACCAGTTTGATGG + Intergenic
973815324 4:54614086-54614108 GGCCCCATGGTTCATTTAGAGGG + Intergenic
975932180 4:79538365-79538387 GGCCCCAGGAATCATGATCGAGG + Intergenic
977194348 4:94040891-94040913 ACCCCCATGAATGATTTTGAGGG - Intergenic
977955250 4:103019053-103019075 GGCACCAGGGATCAGTTTCATGG - Intronic
978317676 4:107457725-107457747 GGCACCAGGGATCAGTTTCATGG - Intergenic
979575453 4:122286001-122286023 GGTCCCATGAATAATTATGAAGG + Intronic
979648728 4:123105653-123105675 GCCCTCAGGGATAATTTTGAGGG + Intronic
980989883 4:139730183-139730205 GGCTCCAGCCATCAATTTGAAGG - Intronic
982560070 4:156918742-156918764 GGCACCAGGGATCAGTTTCACGG - Intronic
983354098 4:166633059-166633081 GGCACCAGAAATCAGTTTCATGG + Intergenic
983631808 4:169857032-169857054 GGCACCAGGAACCAGTTTCATGG + Intergenic
985160982 4:187044307-187044329 GGCACCAGGAATCAGTTTCATGG - Intergenic
985174484 4:187186984-187187006 GGCCCCAGGAATAAGTGAGATGG + Intergenic
985313183 4:188626180-188626202 GGACCCTTGACTCATTTTGATGG - Intergenic
985622275 5:961884-961906 GGCCCCAGGAGACTTTTCGAGGG + Intergenic
986069056 5:4264506-4264528 TGCCCCAAGGATCATTTTCAGGG - Intergenic
987439781 5:17941822-17941844 GGCACCAGGAATCAGTTTTGTGG + Intergenic
987836409 5:23168695-23168717 GGCACCAGGAACCAGTTTCATGG - Intergenic
988150216 5:27367880-27367902 GGCACCAGGAGTCAGTTTCATGG + Intergenic
988167354 5:27611222-27611244 GATTCCAGGAATCATATTGAGGG - Intergenic
988288192 5:29249626-29249648 GGCACAATCAATCATTTTGAAGG - Intergenic
988452468 5:31357092-31357114 GGCACCAGGAACCAGTTTCATGG + Intergenic
988496682 5:31751439-31751461 GGACCCACGATGCATTTTGAAGG + Intronic
988608566 5:32703673-32703695 GGCCTCAGGACTCCTTTTGGTGG + Intronic
989559585 5:42836023-42836045 GGCCCCAGGAACCATGTTCCAGG + Intronic
989659456 5:43784155-43784177 GGACACAGGAACCATTTTAATGG - Intergenic
995572873 5:113499854-113499876 CACCCCAGGAATCATTCTCATGG - Intergenic
995857170 5:116605600-116605622 GAGCCCAGGAATCTTTGTGAAGG + Intergenic
997689349 5:135815166-135815188 GGCACCAGGAACCAGTTTGGTGG + Intergenic
997739500 5:136241210-136241232 CTCCCCAGGAATCATTTTAATGG - Intronic
999502902 5:152164661-152164683 GGCACCAGGGATCAGTTTCATGG - Intergenic
1001874246 5:175185629-175185651 GGCTTCAGCAATCATTTTCATGG - Intergenic
1003344897 6:5257802-5257824 GGCACCAGGAACCAATTTCATGG - Intronic
1005158406 6:22834553-22834575 GGCCCAAGGTGTCATTTTGAGGG + Intergenic
1005472109 6:26171837-26171859 GGCCCCAAGACTCCTTTTCATGG - Intergenic
1009588264 6:65634761-65634783 GGCCTCAGGAAATATTTTGATGG - Intronic
1009629040 6:66170724-66170746 GGGCTCTTGAATCATTTTGAAGG - Intergenic
1010262117 6:73829456-73829478 GCCCCCAGGAATCACTGGGAAGG - Intergenic
1012578417 6:100831608-100831630 GGCCCCAGGAATCATTTTGATGG - Intronic
1013166085 6:107593440-107593462 GGCTCCAAGAATCACTGTGATGG - Intronic
1015985614 6:138881440-138881462 GGCACCAGGAACCAGTTTCATGG + Intronic
1016326865 6:142912809-142912831 GGCACCAGGAACCAGTTTCATGG - Intronic
1016441156 6:144084796-144084818 GGCCCCAGGGACCAGTTTCATGG - Intergenic
1016905621 6:149147936-149147958 GACCCCAGGAAATATTTGGATGG - Intergenic
1017295869 6:152793230-152793252 GGCCCCGGGAATAGTTTGGAGGG + Intergenic
1017396863 6:154010913-154010935 GTTTCCAGGAAACATTTTGATGG - Exonic
1019879917 7:3849645-3849667 GGCCAGAGAATTCATTTTGATGG + Intronic
1021682932 7:23153200-23153222 CGCCTCAGGAATTGTTTTGAAGG - Intronic
1022829186 7:34047584-34047606 GAGCCCAGGAATCATTAAGAAGG - Intronic
1023099624 7:36703196-36703218 GCCCTCAAGAATGATTTTGAGGG - Intronic
1026152275 7:67798271-67798293 GGCACCAGGAACCAGTTTCATGG + Intergenic
1026379264 7:69782854-69782876 GTCCCTAGGAATTATTTTAATGG + Intronic
1027288210 7:76672371-76672393 GGCCCCAGGAATGAGTTTTGAGG + Intergenic
1027501441 7:78956940-78956962 GGCCAAATGAAACATTTTGATGG + Intronic
1028363189 7:89993887-89993909 GGCCACAAAAATCACTTTGAGGG - Intergenic
1028713093 7:93933537-93933559 AGCCCAAGGAATCTTGTTGAAGG - Intergenic
1029151479 7:98483680-98483702 GATCCCAGGAAGCATTTTCAGGG - Intergenic
1029976651 7:104841236-104841258 GATCCCAGGGATCATTTTCAGGG + Intronic
1031135766 7:117882522-117882544 GGCACCAGGAACCAGTTTTATGG + Intergenic
1031982572 7:128137072-128137094 TGCCACAGGAATCATTGTGAGGG + Intergenic
1033497332 7:141912364-141912386 GGCCCTATTAATCATTTTTAAGG - Intronic
1036382669 8:8247715-8247737 GGCACCAGGAACCAGTTTCATGG - Intergenic
1036966315 8:13301939-13301961 GGCACCAGGAACCAGTTTCATGG - Intronic
1041543784 8:59017393-59017415 TGCCTCAGGTACCATTTTGAAGG - Intronic
1042928497 8:73990695-73990717 GGCCTCAGGGATCAGTTTCATGG - Intergenic
1043758728 8:84036984-84037006 GGCACCATGACTCATTTGGATGG - Intergenic
1046821803 8:118642099-118642121 GGACCCAGGAATCTTTTCGGAGG + Intergenic
1052311831 9:27076008-27076030 GGCCGCAGGCCTCATTTTCATGG - Intergenic
1055374677 9:75636126-75636148 GGCACCAGGGATCAGTTTCATGG - Intergenic
1055981223 9:82003402-82003424 GGACCCAGATATCAGTTTGAAGG - Intergenic
1058359205 9:104122961-104122983 GGTTACAGGAATAATTTTGACGG - Intronic
1058918780 9:109593552-109593574 AGCCCCAGGTATCCTTTTGTAGG - Intergenic
1059051626 9:110932855-110932877 GGCCCCAGGAATCACTTTCATGG - Intronic
1059115681 9:111598791-111598813 GGCCCTACGTATCATTTTTACGG + Intronic
1059730778 9:117054816-117054838 GGCACCAGGGATCAGTTTCATGG + Intronic
1060064675 9:120494471-120494493 AGGCACAGGAATCAATTTGAAGG + Intronic
1060860115 9:126947112-126947134 GACCACAAGAATCAATTTGAAGG - Intronic
1062680461 9:137776455-137776477 GGCCCCAGGCATCGTTAAGAAGG - Intronic
1185728132 X:2439451-2439473 GGCACCAGGAACCAGTTTCATGG + Intronic
1186996716 X:15131431-15131453 GGCACCAGGGATCAATTTCATGG - Intergenic
1189579291 X:42388897-42388919 GATCCCAGGAAGCATTGTGAGGG + Intergenic
1189752656 X:44238264-44238286 GGATCCTGGAATTATTTTGAGGG - Intronic
1197145582 X:123168680-123168702 GGCAGCAGAAATCATGTTGAGGG + Intergenic
1197452604 X:126638732-126638754 GGCACCAGGGATCAGTTTCATGG + Intergenic
1201056630 Y:9999776-9999798 GTCAACAGGAATTATTTTGAAGG + Intergenic