ID: 1012579990

View in Genome Browser
Species Human (GRCh38)
Location 6:100855637-100855659
Sequence GGAAACTGCTTAGGTAAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012579990_1012579993 3 Left 1012579990 6:100855637-100855659 CCTGACTTACCTAAGCAGTTTCC 0: 1
1: 0
2: 0
3: 9
4: 123
Right 1012579993 6:100855663-100855685 TCTTTGAACCAGTACATCACTGG 0: 1
1: 0
2: 1
3: 2
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012579990 Original CRISPR GGAAACTGCTTAGGTAAGTC AGG (reversed) Intronic
903137751 1:21320519-21320541 GGAAAGTGCTTAGCACAGTCTGG - Intronic
908389410 1:63671194-63671216 AGAAAGTTCTTAGGTAAGTAGGG - Intergenic
909432619 1:75607066-75607088 GGAAGCTGGATATGTAAGTCTGG - Intronic
909705720 1:78581377-78581399 GGAAAATGCTTAAATAATTCTGG + Intergenic
910142494 1:84041280-84041302 GCAAACAGATTAGGTAAATCAGG + Intergenic
911781864 1:101890011-101890033 GGGAACTGATTAAGTAAATCAGG + Intronic
913280707 1:117182470-117182492 GGAAATTGCTCAGGCAAGCCAGG - Intronic
914426352 1:147580693-147580715 GGAAATTGCTTAGGTAACTTGGG - Intronic
914508077 1:148306578-148306600 GCCTCCTGCTTAGGTAAGTCAGG - Intergenic
914863749 1:151408172-151408194 GGGAAATGATTAGGGAAGTCTGG + Exonic
915886223 1:159723924-159723946 GGAAACTGTTGTGGAAAGTCAGG - Intergenic
918675225 1:187276317-187276339 GAAAACTGCTAATGTAAGTAAGG - Intergenic
920447722 1:206032152-206032174 GGAAACTGATTCAGAAAGTCTGG - Intergenic
921900947 1:220450259-220450281 GGATACTGTTTAGGAAAATCAGG - Intergenic
923013969 1:230111855-230111877 GGCCACTTCTTAGGTAAGACAGG - Intronic
1066793342 10:39090649-39090671 TGAAACTGCTTAGTGAAGTGTGG + Intergenic
1066927564 10:41716875-41716897 GGAAACTGCTTTGTGAAGTGTGG + Intergenic
1068720365 10:60238575-60238597 GTCAACTGCTGAGGTAAGGCAGG + Intronic
1069069568 10:63979339-63979361 GAAAACTGCACAGTTAAGTCTGG - Intergenic
1070656545 10:78275541-78275563 GGAAACTGCTGAGGTCACCCAGG + Intergenic
1072247149 10:93553912-93553934 GGAAGCTGCTCAGCTAAGTCTGG + Intergenic
1072276162 10:93825528-93825550 GGAGACTGTTGAAGTAAGTCTGG + Intergenic
1073851077 10:107619042-107619064 GGAAACTGCCATGGTCAGTCAGG + Intergenic
1082295586 11:50438103-50438125 GGAAACTGTTGCGGGAAGTCAGG + Intergenic
1094558005 12:31522282-31522304 GGAAACTTCTTAGGAAAGCATGG + Intronic
1099076031 12:78110352-78110374 GGAAATTGCTTTGGGAAGTATGG - Intronic
1099466154 12:82990535-82990557 AGGAACTGCTTAAGAAAGTCAGG - Intronic
1099928420 12:89045946-89045968 GGAAAGTCCTTGGGTAAATCTGG + Intergenic
1101479044 12:105079078-105079100 ATAGACTGCTTAGGTAACTCTGG + Intronic
1103528307 12:121581876-121581898 GGAAACTTCTAAGGTGAGTGAGG - Intergenic
1104877404 12:132045227-132045249 GGAAACAGGTCAGGCAAGTCTGG - Intronic
1106954222 13:34917928-34917950 GTAAATTGCCTAGTTAAGTCTGG + Intergenic
1107284623 13:38777361-38777383 GAAAACTGCTCAGGTTAGCCAGG - Intronic
1109433804 13:62272562-62272584 GGAAACTGCTTAAGGCAGACTGG - Intergenic
1110538808 13:76684509-76684531 GGATACTGCCTAGGAAAGTGGGG - Intergenic
1111097429 13:83534116-83534138 GGAAGCTGGATAGGGAAGTCAGG - Intergenic
1112095168 13:96124715-96124737 GAAAACTGCTTAGTTAAACCAGG - Intronic
1112525944 13:100147134-100147156 TGAAAATGCTTAGGTAAGTTTGG + Intronic
1121251314 14:92501728-92501750 GGAAGCTGCTGAGGTAAGACTGG - Intergenic
1122367392 14:101202232-101202254 GGAAACGGCTTAGGTATCTTGGG + Intergenic
1126603869 15:50456278-50456300 AGAAACTGCTTAGGCCAGGCGGG + Intronic
1128437558 15:67669563-67669585 GGAAAATGTTTTGGTAATTCAGG + Intronic
1129747637 15:78035792-78035814 GGAAACTGCTTAAATAACTTAGG + Intronic
1132356988 15:101179153-101179175 AGAAACTGCTTAAGGAAGTAAGG + Intronic
1134059533 16:11190859-11190881 AGAAACTGCTTAGCTAAGCCTGG - Intergenic
1135027270 16:19008108-19008130 GGTAATTGCTTAGGTAATTATGG + Intronic
1135409897 16:22225695-22225717 GGATACTGCTTGGGTAAAACGGG + Exonic
1136742340 16:32547696-32547718 TGAAACTGCTTTGGGAAGTGTGG + Intergenic
1141965481 16:87439446-87439468 GGAGACTGCTTAGCAAAGTGAGG - Intronic
1203027259 16_KI270728v1_random:527533-527555 TGAAACTGCTTTGGGAAGTGTGG - Intergenic
1203044462 16_KI270728v1_random:806898-806920 TGAAACTGCTTTGGGAAGTGTGG + Intergenic
1142737740 17:1912230-1912252 GGAAATTCCTTTGGTCAGTCTGG + Intergenic
1153415751 18:4844134-4844156 GGAAAATGCAAAGGTAATTCAGG - Intergenic
1157654129 18:49368834-49368856 GGAAACTGCTTGTGTTAGACAGG + Intronic
1158873910 18:61714449-61714471 GGAAACTTCTCAGGTTAGACAGG + Intergenic
1162077940 19:8201148-8201170 GGAAACTGATAAGCAAAGTCTGG + Intronic
1162717687 19:12644236-12644258 GGAAACAGCTTAGGTCAGCTAGG - Intronic
1164330878 19:24254387-24254409 TGAAACTGCTTTGTTAAGTGTGG - Intergenic
1164332747 19:24275875-24275897 TGAAACTGCTTTGTTAAGTGTGG - Intergenic
1164363271 19:27542825-27542847 TGAAACTGCTTTGTTAAGTGTGG + Intergenic
1164369682 19:27633624-27633646 TGAAACTGCTTTGTTAAGTGTGG + Intergenic
1164889488 19:31811029-31811051 GGAAACTGCTGCTGTAAGACAGG + Intergenic
1167088028 19:47324021-47324043 GGAGACTGCTGAGGTCAGTCTGG - Intergenic
927122339 2:19977557-19977579 GGAAACTGCTCTGGCAATTCAGG - Intronic
927188872 2:20502289-20502311 GGAGATTGCTTACGCAAGTCGGG - Intergenic
929681190 2:43995475-43995497 GAAGACTGCTTTGGGAAGTCGGG - Intronic
930184268 2:48395867-48395889 GGAAACTGCGATGGTAAGACTGG + Intergenic
930599246 2:53424611-53424633 GGGACCTGCATAGGAAAGTCTGG + Intergenic
931072071 2:58663178-58663200 AGAAACTCCTGAGATAAGTCTGG + Intergenic
935118749 2:100161244-100161266 GGCAACTGTTAAGGTAGGTCCGG + Intergenic
935164190 2:100555331-100555353 GGAAAATGCTTACGATAGTCTGG + Intergenic
937054486 2:118921674-118921696 GGAACCTGCTTTGGTGCGTCCGG - Intergenic
937194403 2:120138748-120138770 GCAAACTGCTTTGGGAAGTATGG - Intronic
938024392 2:127933317-127933339 AGAAACTGCTTTGGTGAGTGAGG - Intergenic
946004052 2:216507828-216507850 GGAAATTGTTAAGGAAAGTCCGG + Intronic
1173026200 20:39309753-39309775 GGAATCTGATTAGGTAGGTCTGG + Intergenic
1173083174 20:39889104-39889126 GGAAGCTGCATAGTAAAGTCAGG + Intergenic
1178739634 21:35186253-35186275 GGAAACTGGATAGGTCATTCTGG + Intronic
1182434764 22:30323395-30323417 CGAAAGTGCTGAGCTAAGTCAGG + Intronic
1183487822 22:38098831-38098853 GGATTCTGCTTGGGAAAGTCAGG - Intronic
1184527515 22:45034202-45034224 GGAAACTGCGTCTCTAAGTCAGG - Intergenic
949143183 3:661310-661332 GGAGACAGTTTAGGTAAGACTGG - Intergenic
953282572 3:41573343-41573365 TGAAACTGCTTTGGAAAGGCTGG - Intronic
956748062 3:72325111-72325133 GGAAACTGCTGTGGTAATGCAGG + Intergenic
960735647 3:120776730-120776752 GGAAACTGCCTGGGCAATTCTGG + Intronic
961174849 3:124826388-124826410 TGAAACTGCACAGGTAAGTAGGG - Intronic
962953026 3:140237576-140237598 GGAAACTGCTAAGCTCTGTCTGG + Intronic
966531449 3:180986161-180986183 GGAAACTACTTAGAAAAGTAAGG + Intronic
975390674 4:73813549-73813571 GGAAACTGCTGAGTTAATCCAGG + Intergenic
976737762 4:88328147-88328169 GGAATCTGATTTAGTAAGTCTGG - Intergenic
976912260 4:90322555-90322577 GTAGATTGCTTAGGTAAGTGTGG + Intronic
978305776 4:107327185-107327207 GTACACTGCTTAGGAAAGTATGG + Intergenic
984227988 4:177058512-177058534 GTAAACTGCTTTGGGAAGTGTGG - Intergenic
985126577 4:186700918-186700940 GGAAACAGCTTACGTCAGACAGG - Intronic
986833374 5:11607075-11607097 GGAACCTGCTTCTGTAAGCCAGG + Intronic
989842064 5:46088649-46088671 AGAAACTTCTTAGGGATGTCTGG + Intergenic
992037251 5:72792323-72792345 GGAAACTGCTTAGGGCAAACCGG - Intergenic
992448239 5:76852920-76852942 GATGACTGCTTAGGCAAGTCAGG + Intronic
994409091 5:99383614-99383636 GTAAACTGCTTTGGTCAGTATGG - Intergenic
1004136413 6:12971468-12971490 GGAAATTGGTAAGGTAAGCCTGG + Intronic
1010427947 6:75747555-75747577 GGAAACTGGTTAGGTGACTTAGG + Intergenic
1010533058 6:76990826-76990848 TGAAACTGGGTAGGGAAGTCAGG - Intergenic
1011095624 6:83658811-83658833 GTAAACTGCTTAGAAAAATCAGG + Intronic
1012377426 6:98579328-98579350 GGAGCCTGCCTGGGTAAGTCTGG - Intergenic
1012579990 6:100855637-100855659 GGAAACTGCTTAGGTAAGTCAGG - Intronic
1012729174 6:102858643-102858665 GAAAACTGATTATCTAAGTCAGG + Intergenic
1013598020 6:111678598-111678620 GGAAATTGGTTATGCAAGTCAGG - Intronic
1016896907 6:149062554-149062576 GGGGAATGCTTTGGTAAGTCTGG - Intronic
1018078904 6:160241992-160242014 AGAAACAGCTTAGGGAAGCCAGG - Intronic
1020937522 7:14486164-14486186 GGAAAATGCTGAAGTAAGGCAGG - Intronic
1024653827 7:51432268-51432290 GGGAAATGCTTAGGTAGGTTGGG - Intergenic
1025599396 7:62976511-62976533 GGAAACTGTTGTGGGAAGTCAGG + Intergenic
1027745043 7:82062309-82062331 TGAAGCTGCACAGGTAAGTCTGG - Intronic
1034173939 7:149085669-149085691 GGAAACTGCTTTGGGCAGTATGG + Intronic
1040282192 8:46064021-46064043 GGAAACTGCTTTGTAAAGTGTGG + Intergenic
1040332345 8:46392702-46392724 GGAAACTGCTTTGGGATGTGTGG - Intergenic
1049383075 8:142327032-142327054 GGCAGCTGCTTTGGAAAGTCTGG + Intronic
1050139328 9:2501328-2501350 GGAAACTGCTTGTATCAGTCAGG + Intergenic
1050490744 9:6185440-6185462 GGAAACTGCATAGGTGATTTGGG + Intergenic
1052890241 9:33692453-33692475 ATAAACTTCTTAGGTAAGTCTGG + Intergenic
1055750601 9:79500766-79500788 GTAAAGTGCTTAGGAAACTCTGG - Intergenic
1061892551 9:133630329-133630351 GGAAACTGATTATGAAAGTACGG + Intergenic
1188343328 X:29032369-29032391 GGATTCTGCTTAGGTAGATCTGG - Intronic
1190054210 X:47172500-47172522 GGAAACTGCAGAGGCAATTCAGG - Intronic
1191578823 X:62737613-62737635 TGAAACTGCTTGGTTATGTCTGG - Intergenic
1191951506 X:66598383-66598405 GGAAACTGATGAGGTCTGTCTGG + Intronic
1193961395 X:87929305-87929327 GGAAATTGCTTTGGGAAGTATGG - Intergenic
1196400775 X:115313659-115313681 AGAGACTGCTTAGTTAAGTGAGG - Intergenic
1196502218 X:116398224-116398246 GTAAATTGCTTAGGGAAGTATGG + Intergenic
1197146541 X:123178465-123178487 GGAAACAGCATAGGCAAGTCAGG - Intergenic
1198858420 X:141043720-141043742 AGAAACTGTTAAGGTAATTCAGG + Intergenic
1198904279 X:141543668-141543690 AGAAACTGTTAAGGTAATTCAGG - Intergenic
1199448749 X:147956299-147956321 GGAAACTGCTTAGTTAGTACTGG + Intergenic