ID: 1012582843

View in Genome Browser
Species Human (GRCh38)
Location 6:100889890-100889912
Sequence CTGGATAAGGACCACCAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012582843_1012582847 -7 Left 1012582843 6:100889890-100889912 CCCACCTGGTGGTCCTTATCCAG No data
Right 1012582847 6:100889906-100889928 TATCCAGCCTCAACTGTGCCAGG 0: 1
1: 1
2: 1
3: 15
4: 166
1012582843_1012582852 8 Left 1012582843 6:100889890-100889912 CCCACCTGGTGGTCCTTATCCAG No data
Right 1012582852 6:100889921-100889943 GTGCCAGGCCCTGGCCCATAGGG 0: 1
1: 0
2: 2
3: 28
4: 270
1012582843_1012582849 -1 Left 1012582843 6:100889890-100889912 CCCACCTGGTGGTCCTTATCCAG No data
Right 1012582849 6:100889912-100889934 GCCTCAACTGTGCCAGGCCCTGG 0: 1
1: 0
2: 5
3: 53
4: 419
1012582843_1012582851 7 Left 1012582843 6:100889890-100889912 CCCACCTGGTGGTCCTTATCCAG No data
Right 1012582851 6:100889920-100889942 TGTGCCAGGCCCTGGCCCATAGG 0: 1
1: 0
2: 2
3: 52
4: 408

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012582843 Original CRISPR CTGGATAAGGACCACCAGGT GGG (reversed) Intergenic
No off target data available for this crispr