ID: 1012586569

View in Genome Browser
Species Human (GRCh38)
Location 6:100930486-100930508
Sequence TTCAAAAGAAGACATACATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 15348
Summary {0: 440, 1: 1028, 2: 1915, 3: 5291, 4: 6674}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012586569_1012586575 26 Left 1012586569 6:100930486-100930508 CCACATGTATGTCTTCTTTTGAA 0: 440
1: 1028
2: 1915
3: 5291
4: 6674
Right 1012586575 6:100930535-100930557 CTTTTTAATGGGATTTTGGTTGG No data
1012586569_1012586570 14 Left 1012586569 6:100930486-100930508 CCACATGTATGTCTTCTTTTGAA 0: 440
1: 1028
2: 1915
3: 5291
4: 6674
Right 1012586570 6:100930523-100930545 GTCCTTTGCCGACTTTTTAATGG No data
1012586569_1012586571 15 Left 1012586569 6:100930486-100930508 CCACATGTATGTCTTCTTTTGAA 0: 440
1: 1028
2: 1915
3: 5291
4: 6674
Right 1012586571 6:100930524-100930546 TCCTTTGCCGACTTTTTAATGGG No data
1012586569_1012586574 22 Left 1012586569 6:100930486-100930508 CCACATGTATGTCTTCTTTTGAA 0: 440
1: 1028
2: 1915
3: 5291
4: 6674
Right 1012586574 6:100930531-100930553 CCGACTTTTTAATGGGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012586569 Original CRISPR TTCAAAAGAAGACATACATG TGG (reversed) Intergenic
Too many off-targets to display for this crispr