ID: 1012586575

View in Genome Browser
Species Human (GRCh38)
Location 6:100930535-100930557
Sequence CTTTTTAATGGGATTTTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012586569_1012586575 26 Left 1012586569 6:100930486-100930508 CCACATGTATGTCTTCTTTTGAA 0: 440
1: 1028
2: 1915
3: 5291
4: 6674
Right 1012586575 6:100930535-100930557 CTTTTTAATGGGATTTTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012586575 Original CRISPR CTTTTTAATGGGATTTTGGT TGG Intergenic
No off target data available for this crispr