ID: 1012591991

View in Genome Browser
Species Human (GRCh38)
Location 6:100993159-100993181
Sequence CTTAAGAAACATTTGGGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012591991_1012591997 25 Left 1012591991 6:100993159-100993181 CCAAGCCCCAAATGTTTCTTAAG No data
Right 1012591997 6:100993207-100993229 TTTAGTTTTCTTCTTTAATATGG No data
1012591991_1012591998 26 Left 1012591991 6:100993159-100993181 CCAAGCCCCAAATGTTTCTTAAG No data
Right 1012591998 6:100993208-100993230 TTAGTTTTCTTCTTTAATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012591991 Original CRISPR CTTAAGAAACATTTGGGGCT TGG (reversed) Intergenic
No off target data available for this crispr