ID: 1012598442

View in Genome Browser
Species Human (GRCh38)
Location 6:101066707-101066729
Sequence AGGTGCCACCCCCTGCTCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012598442_1012598449 15 Left 1012598442 6:101066707-101066729 CCGCAGAGCAGGGGGTGGCACCT No data
Right 1012598449 6:101066745-101066767 GCTGCACAAGAGCCTACCGTTGG No data
1012598442_1012598453 19 Left 1012598442 6:101066707-101066729 CCGCAGAGCAGGGGGTGGCACCT No data
Right 1012598453 6:101066749-101066771 CACAAGAGCCTACCGTTGGGGGG No data
1012598442_1012598452 18 Left 1012598442 6:101066707-101066729 CCGCAGAGCAGGGGGTGGCACCT No data
Right 1012598452 6:101066748-101066770 GCACAAGAGCCTACCGTTGGGGG No data
1012598442_1012598450 16 Left 1012598442 6:101066707-101066729 CCGCAGAGCAGGGGGTGGCACCT No data
Right 1012598450 6:101066746-101066768 CTGCACAAGAGCCTACCGTTGGG No data
1012598442_1012598446 -8 Left 1012598442 6:101066707-101066729 CCGCAGAGCAGGGGGTGGCACCT No data
Right 1012598446 6:101066722-101066744 TGGCACCTGTCAGGGAGGCTCGG No data
1012598442_1012598451 17 Left 1012598442 6:101066707-101066729 CCGCAGAGCAGGGGGTGGCACCT No data
Right 1012598451 6:101066747-101066769 TGCACAAGAGCCTACCGTTGGGG No data
1012598442_1012598447 -7 Left 1012598442 6:101066707-101066729 CCGCAGAGCAGGGGGTGGCACCT No data
Right 1012598447 6:101066723-101066745 GGCACCTGTCAGGGAGGCTCGGG No data
1012598442_1012598455 25 Left 1012598442 6:101066707-101066729 CCGCAGAGCAGGGGGTGGCACCT No data
Right 1012598455 6:101066755-101066777 AGCCTACCGTTGGGGGGGCTTGG No data
1012598442_1012598454 20 Left 1012598442 6:101066707-101066729 CCGCAGAGCAGGGGGTGGCACCT No data
Right 1012598454 6:101066750-101066772 ACAAGAGCCTACCGTTGGGGGGG No data
1012598442_1012598456 26 Left 1012598442 6:101066707-101066729 CCGCAGAGCAGGGGGTGGCACCT No data
Right 1012598456 6:101066756-101066778 GCCTACCGTTGGGGGGGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012598442 Original CRISPR AGGTGCCACCCCCTGCTCTG CGG (reversed) Intergenic