ID: 1012598448

View in Genome Browser
Species Human (GRCh38)
Location 6:101066727-101066749
Sequence GCAGCCCGAGCCTCCCTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012598448_1012598460 15 Left 1012598448 6:101066727-101066749 CCTGTCAGGGAGGCTCGGGCTGC No data
Right 1012598460 6:101066765-101066787 TGGGGGGGCTTGGGCATGGCAGG No data
1012598448_1012598456 6 Left 1012598448 6:101066727-101066749 CCTGTCAGGGAGGCTCGGGCTGC No data
Right 1012598456 6:101066756-101066778 GCCTACCGTTGGGGGGGCTTGGG No data
1012598448_1012598452 -2 Left 1012598448 6:101066727-101066749 CCTGTCAGGGAGGCTCGGGCTGC No data
Right 1012598452 6:101066748-101066770 GCACAAGAGCCTACCGTTGGGGG No data
1012598448_1012598453 -1 Left 1012598448 6:101066727-101066749 CCTGTCAGGGAGGCTCGGGCTGC No data
Right 1012598453 6:101066749-101066771 CACAAGAGCCTACCGTTGGGGGG No data
1012598448_1012598455 5 Left 1012598448 6:101066727-101066749 CCTGTCAGGGAGGCTCGGGCTGC No data
Right 1012598455 6:101066755-101066777 AGCCTACCGTTGGGGGGGCTTGG No data
1012598448_1012598451 -3 Left 1012598448 6:101066727-101066749 CCTGTCAGGGAGGCTCGGGCTGC No data
Right 1012598451 6:101066747-101066769 TGCACAAGAGCCTACCGTTGGGG No data
1012598448_1012598450 -4 Left 1012598448 6:101066727-101066749 CCTGTCAGGGAGGCTCGGGCTGC No data
Right 1012598450 6:101066746-101066768 CTGCACAAGAGCCTACCGTTGGG No data
1012598448_1012598454 0 Left 1012598448 6:101066727-101066749 CCTGTCAGGGAGGCTCGGGCTGC No data
Right 1012598454 6:101066750-101066772 ACAAGAGCCTACCGTTGGGGGGG No data
1012598448_1012598449 -5 Left 1012598448 6:101066727-101066749 CCTGTCAGGGAGGCTCGGGCTGC No data
Right 1012598449 6:101066745-101066767 GCTGCACAAGAGCCTACCGTTGG No data
1012598448_1012598459 11 Left 1012598448 6:101066727-101066749 CCTGTCAGGGAGGCTCGGGCTGC No data
Right 1012598459 6:101066761-101066783 CCGTTGGGGGGGCTTGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012598448 Original CRISPR GCAGCCCGAGCCTCCCTGAC AGG (reversed) Intergenic