ID: 1012598449 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:101066745-101066767 |
Sequence | GCTGCACAAGAGCCTACCGT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1012598448_1012598449 | -5 | Left | 1012598448 | 6:101066727-101066749 | CCTGTCAGGGAGGCTCGGGCTGC | No data | ||
Right | 1012598449 | 6:101066745-101066767 | GCTGCACAAGAGCCTACCGTTGG | No data | ||||
1012598442_1012598449 | 15 | Left | 1012598442 | 6:101066707-101066729 | CCGCAGAGCAGGGGGTGGCACCT | No data | ||
Right | 1012598449 | 6:101066745-101066767 | GCTGCACAAGAGCCTACCGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1012598449 | Original CRISPR | GCTGCACAAGAGCCTACCGT TGG | Intergenic | ||