ID: 1012598449

View in Genome Browser
Species Human (GRCh38)
Location 6:101066745-101066767
Sequence GCTGCACAAGAGCCTACCGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012598448_1012598449 -5 Left 1012598448 6:101066727-101066749 CCTGTCAGGGAGGCTCGGGCTGC No data
Right 1012598449 6:101066745-101066767 GCTGCACAAGAGCCTACCGTTGG No data
1012598442_1012598449 15 Left 1012598442 6:101066707-101066729 CCGCAGAGCAGGGGGTGGCACCT No data
Right 1012598449 6:101066745-101066767 GCTGCACAAGAGCCTACCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012598449 Original CRISPR GCTGCACAAGAGCCTACCGT TGG Intergenic