ID: 1012599849

View in Genome Browser
Species Human (GRCh38)
Location 6:101082170-101082192
Sequence GTGATCACCCTCTCAAATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012599849_1012599850 -8 Left 1012599849 6:101082170-101082192 CCTTGATTTGAGAGGGTGATCAC No data
Right 1012599850 6:101082185-101082207 GTGATCACAAAATAACTCTGAGG No data
1012599849_1012599851 5 Left 1012599849 6:101082170-101082192 CCTTGATTTGAGAGGGTGATCAC No data
Right 1012599851 6:101082198-101082220 AACTCTGAGGTTGAGAACCTAGG No data
1012599849_1012599852 12 Left 1012599849 6:101082170-101082192 CCTTGATTTGAGAGGGTGATCAC No data
Right 1012599852 6:101082205-101082227 AGGTTGAGAACCTAGGTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012599849 Original CRISPR GTGATCACCCTCTCAAATCA AGG (reversed) Intergenic
No off target data available for this crispr