ID: 1012601649

View in Genome Browser
Species Human (GRCh38)
Location 6:101105790-101105812
Sequence AGTATATACAAGCATATATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012601647_1012601649 13 Left 1012601647 6:101105754-101105776 CCTACTTACACTGTACAAATTTA No data
Right 1012601649 6:101105790-101105812 AGTATATACAAGCATATATAAGG No data
1012601646_1012601649 25 Left 1012601646 6:101105742-101105764 CCTGGAAAATTGCCTACTTACAC No data
Right 1012601649 6:101105790-101105812 AGTATATACAAGCATATATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012601649 Original CRISPR AGTATATACAAGCATATATA AGG Intergenic
No off target data available for this crispr