ID: 1012606065

View in Genome Browser
Species Human (GRCh38)
Location 6:101158817-101158839
Sequence CATTGTAGTAGCCTCTTAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012606065_1012606071 22 Left 1012606065 6:101158817-101158839 CCAATTAAGAGGCTACTACAATG No data
Right 1012606071 6:101158862-101158884 GGTTGAACTAAATTAGTTGCAGG No data
1012606065_1012606069 1 Left 1012606065 6:101158817-101158839 CCAATTAAGAGGCTACTACAATG No data
Right 1012606069 6:101158841-101158863 TCCAGGTAGGATGTAATAGTAGG No data
1012606065_1012606073 24 Left 1012606065 6:101158817-101158839 CCAATTAAGAGGCTACTACAATG No data
Right 1012606073 6:101158864-101158886 TTGAACTAAATTAGTTGCAGGGG No data
1012606065_1012606072 23 Left 1012606065 6:101158817-101158839 CCAATTAAGAGGCTACTACAATG No data
Right 1012606072 6:101158863-101158885 GTTGAACTAAATTAGTTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012606065 Original CRISPR CATTGTAGTAGCCTCTTAAT TGG (reversed) Intergenic
No off target data available for this crispr