ID: 1012606071

View in Genome Browser
Species Human (GRCh38)
Location 6:101158862-101158884
Sequence GGTTGAACTAAATTAGTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012606070_1012606071 -3 Left 1012606070 6:101158842-101158864 CCAGGTAGGATGTAATAGTAGGT No data
Right 1012606071 6:101158862-101158884 GGTTGAACTAAATTAGTTGCAGG No data
1012606065_1012606071 22 Left 1012606065 6:101158817-101158839 CCAATTAAGAGGCTACTACAATG No data
Right 1012606071 6:101158862-101158884 GGTTGAACTAAATTAGTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012606071 Original CRISPR GGTTGAACTAAATTAGTTGC AGG Intergenic
No off target data available for this crispr