ID: 1012612252

View in Genome Browser
Species Human (GRCh38)
Location 6:101230633-101230655
Sequence GGAAACTGGTCTGGGTGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012612246_1012612252 3 Left 1012612246 6:101230607-101230629 CCATCTGAAACCAAGTGTCTATG No data
Right 1012612252 6:101230633-101230655 GGAAACTGGTCTGGGTGTCCTGG No data
1012612248_1012612252 -7 Left 1012612248 6:101230617-101230639 CCAAGTGTCTATGTATGGAAACT 0: 14
1: 33
2: 35
3: 49
4: 206
Right 1012612252 6:101230633-101230655 GGAAACTGGTCTGGGTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012612252 Original CRISPR GGAAACTGGTCTGGGTGTCC TGG Intergenic
No off target data available for this crispr