ID: 1012612408

View in Genome Browser
Species Human (GRCh38)
Location 6:101231800-101231822
Sequence CTCTAGGTTGCTATCCTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012612408_1012612414 26 Left 1012612408 6:101231800-101231822 CCTACCAGGATAGCAACCTAGAG No data
Right 1012612414 6:101231849-101231871 TTTGCAAAAAAGCTAGCACGGGG No data
1012612408_1012612411 -2 Left 1012612408 6:101231800-101231822 CCTACCAGGATAGCAACCTAGAG No data
Right 1012612411 6:101231821-101231843 AGAAGCTGAATCACTAGTTGAGG No data
1012612408_1012612413 25 Left 1012612408 6:101231800-101231822 CCTACCAGGATAGCAACCTAGAG No data
Right 1012612413 6:101231848-101231870 TTTTGCAAAAAAGCTAGCACGGG No data
1012612408_1012612412 24 Left 1012612408 6:101231800-101231822 CCTACCAGGATAGCAACCTAGAG No data
Right 1012612412 6:101231847-101231869 CTTTTGCAAAAAAGCTAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012612408 Original CRISPR CTCTAGGTTGCTATCCTGGT AGG (reversed) Intergenic
No off target data available for this crispr