ID: 1012612935

View in Genome Browser
Species Human (GRCh38)
Location 6:101237657-101237679
Sequence TACCTCAGAGCTCTGTTATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012612935_1012612936 6 Left 1012612935 6:101237657-101237679 CCTCATAACAGAGCTCTGAGGTA No data
Right 1012612936 6:101237686-101237708 TTACCTTCTTTTCACATTTGAGG No data
1012612935_1012612940 26 Left 1012612935 6:101237657-101237679 CCTCATAACAGAGCTCTGAGGTA No data
Right 1012612940 6:101237706-101237728 AGGAAATGCAGGTTTAGAGAGGG No data
1012612935_1012612938 15 Left 1012612935 6:101237657-101237679 CCTCATAACAGAGCTCTGAGGTA No data
Right 1012612938 6:101237695-101237717 TTTCACATTTGAGGAAATGCAGG No data
1012612935_1012612939 25 Left 1012612935 6:101237657-101237679 CCTCATAACAGAGCTCTGAGGTA No data
Right 1012612939 6:101237705-101237727 GAGGAAATGCAGGTTTAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012612935 Original CRISPR TACCTCAGAGCTCTGTTATG AGG (reversed) Intergenic
No off target data available for this crispr