ID: 1012616364

View in Genome Browser
Species Human (GRCh38)
Location 6:101283787-101283809
Sequence AGAACACTGGTGGGGGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 711
Summary {0: 14, 1: 29, 2: 65, 3: 147, 4: 456}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012616364_1012616376 28 Left 1012616364 6:101283787-101283809 CCAGCCACCCCCACCAGTGTTCT 0: 14
1: 29
2: 65
3: 147
4: 456
Right 1012616376 6:101283838-101283860 GAGACTGAGCTCCCAGAGGGAGG No data
1012616364_1012616373 24 Left 1012616364 6:101283787-101283809 CCAGCCACCCCCACCAGTGTTCT 0: 14
1: 29
2: 65
3: 147
4: 456
Right 1012616373 6:101283834-101283856 CCCTGAGACTGAGCTCCCAGAGG No data
1012616364_1012616377 29 Left 1012616364 6:101283787-101283809 CCAGCCACCCCCACCAGTGTTCT 0: 14
1: 29
2: 65
3: 147
4: 456
Right 1012616377 6:101283839-101283861 AGACTGAGCTCCCAGAGGGAGGG No data
1012616364_1012616375 25 Left 1012616364 6:101283787-101283809 CCAGCCACCCCCACCAGTGTTCT 0: 14
1: 29
2: 65
3: 147
4: 456
Right 1012616375 6:101283835-101283857 CCTGAGACTGAGCTCCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012616364 Original CRISPR AGAACACTGGTGGGGGTGGC TGG (reversed) Intergenic
900149016 1:1170203-1170225 AGGACCCTGCTGGGGCTGGCGGG + Intergenic
900347113 1:2215157-2215179 AGAACACTGGCAGGGGTCCCTGG + Intergenic
900615059 1:3561715-3561737 AAAACACGGGGTGGGGTGGCGGG + Intronic
901714762 1:11144524-11144546 AATACACTGGTGGAGGAGGCAGG + Intronic
902736647 1:18405663-18405685 AGAAAAGTGGTGGGGTTGGGGGG - Intergenic
903623424 1:24714654-24714676 AGAACTCTGGAGGGAGAGGCAGG - Intergenic
903731520 1:25499675-25499697 AGAATCAGGGTGGGGGTGGCGGG + Exonic
904311279 1:29631259-29631281 AGAACTCTGGGGGGGGTTGGTGG - Intergenic
904319877 1:29689778-29689800 GGGACCCTGGTGGGGATGGCAGG + Intergenic
905282643 1:36859077-36859099 ACAACACTGGTGGGGGCTGTGGG + Intronic
905527308 1:38648816-38648838 AGAACATGGGTTGGGGGGGCGGG - Intergenic
905649511 1:39646978-39647000 AGGACACTGGGGGTGGTGGCAGG + Intergenic
905853370 1:41290682-41290704 GGAACCCTGGTGGGGGCAGCTGG + Intergenic
907114591 1:51957903-51957925 AACACACCGGTGGGGGAGGCCGG + Intronic
907409496 1:54274433-54274455 AGAGCACTGGCTGGGGTGGGTGG + Intronic
907576162 1:55527785-55527807 AGCTCACAGGTGGGGATGGCAGG + Intergenic
908169642 1:61492016-61492038 AGAATACCTGTGGGGGAGGCGGG - Intergenic
908558926 1:65285562-65285584 GGAACACTGGTGGGGGGGTGAGG - Intronic
909759602 1:79271324-79271346 AGAATATGGGTGGGGCTGGCTGG - Intergenic
911060999 1:93747793-93747815 AGCACACTGGGGGAAGTGGCAGG - Intronic
911794537 1:102059090-102059112 AGAACATGAGTGGGGGTGGCTGG - Intergenic
912436448 1:109665325-109665347 AGAACAAAGGTGGGGGTGGGAGG - Intronic
912438539 1:109680049-109680071 AGAACAAAGGTGGGGGTGGGAGG - Intronic
912441057 1:109698503-109698525 AGAACAAAGGTGGGGGTGGGAGG - Intronic
913430871 1:118789257-118789279 AGAACATTGGCAGGAGTGGCTGG - Intergenic
914414703 1:147469074-147469096 GAAACACTGGTGAGGGTAGCTGG + Intergenic
914713232 1:150234189-150234211 AGAATCCTGGCGGGGGAGGCGGG + Intronic
914801867 1:150968069-150968091 AGAAGCCAGGTGGGGGAGGCTGG - Exonic
914923135 1:151860823-151860845 AGCACAGAGGTAGGGGTGGCTGG - Intergenic
915333946 1:155129810-155129832 AGGACACTGTTGGGGGTGAGTGG + Intronic
915560072 1:156681956-156681978 AGAACACTGCAGGCGGTGGTCGG + Intergenic
915844804 1:159252255-159252277 ACAACACCAGTGGGGGTGGCTGG - Intergenic
916058071 1:161081623-161081645 AACACACTGTTGGGGGTTGCTGG - Intronic
916097344 1:161362931-161362953 AGAAGAGAGGTGGGGGTGGAGGG + Exonic
917149535 1:171929473-171929495 AGAGCATTGGTGAGGATGGCTGG + Intronic
917259234 1:173148883-173148905 AGAACAACGGTTGGGGTGGCTGG + Intergenic
917289836 1:173460907-173460929 AGAACATGGGCGGGGGTGGCTGG - Intergenic
918909598 1:190549254-190549276 AGAGCAATGTTGGGGGAGGCAGG - Intergenic
919707427 1:200690657-200690679 AGGACAGTGATGGGGGTGGGAGG + Intergenic
920823597 1:209403759-209403781 AGAACACTCGAGGGAGAGGCAGG + Intergenic
921013073 1:211161883-211161905 AAAACACTGGTGAGGGTAGCTGG + Intergenic
921013179 1:211162420-211162442 AGAACACTGGTGGGGGTAGCTGG + Intergenic
922384966 1:225073385-225073407 AGAACACTGATGGGGGTGGCTGG + Intronic
922385117 1:225074333-225074355 AGAACACTGGTGGGATTGGCTGG + Intronic
922775708 1:228213408-228213430 AGAAGACTGGTGAGAGGGGCGGG - Exonic
922891941 1:229068294-229068316 AAAACAGTGGTGGGGGTGGGGGG + Intergenic
923271448 1:232358730-232358752 AGGGCAGTGGAGGGGGTGGCTGG + Intergenic
923462811 1:234221720-234221742 AGAACACTGGATGAGGTGTCAGG + Intronic
924065768 1:240220286-240220308 AGAGCAGAGCTGGGGGTGGCTGG - Intronic
924116639 1:240753876-240753898 AGAAAACTGGTAGCGGGGGCAGG - Intergenic
1066269792 10:33811071-33811093 AGACCATTCGTGGGGGTGGGGGG - Intergenic
1067026013 10:42844969-42844991 ACTACGCTGGTGGGGGTGGCTGG - Intergenic
1067353441 10:45499654-45499676 ATGATATTGGTGGGGGTGGCAGG - Intronic
1067578757 10:47425932-47425954 ATAGCCCTGGTGGGGGTGGCTGG - Intergenic
1069053138 10:63815530-63815552 AAAACACTGGCAAGGGTGGCTGG + Intergenic
1069340538 10:67403515-67403537 AGAACATGGGTGAGGGTGGTTGG - Intronic
1070187267 10:74076529-74076551 AGAAGACTGGTGGGAGAGGCAGG - Intronic
1070812762 10:79306572-79306594 AGAACTCGGGTGGGTGTGGGAGG - Intronic
1072525504 10:96267611-96267633 AGAACCCTGCTGTGGGTGTCTGG - Intronic
1072549995 10:96469964-96469986 AGAACTCTTGTGGGCGGGGCAGG + Intronic
1072823529 10:98582911-98582933 AGAAAACGGTTGGGGGTGGCAGG - Intronic
1073100586 10:101004285-101004307 AGACAACTGGTGGGGAGGGCAGG - Intronic
1073178203 10:101569275-101569297 AGGAGACAGGTGGGGGTGGTGGG - Intergenic
1073328033 10:102653729-102653751 AGAACAAGGGAGGGGGTGACTGG + Intronic
1073465854 10:103694132-103694154 GGAACAGTGGAGGGGCTGGCTGG + Intronic
1073709654 10:106022145-106022167 AGAAAAGGGGTGGGGGTGGGGGG + Intergenic
1074270058 10:111944935-111944957 AGAATATGGGTGGGGCTGGCTGG - Intergenic
1075893845 10:125977991-125978013 ACAGCTCTGGCGGGGGTGGCTGG + Intronic
1076630615 10:131849846-131849868 TTACCCCTGGTGGGGGTGGCAGG + Intergenic
1077339732 11:2020952-2020974 AGAGCTCTGGTGGAGCTGGCGGG + Intergenic
1078096612 11:8301196-8301218 AGAACCCTGGTGTGGGTGGCAGG + Intergenic
1079668453 11:23135921-23135943 ACAACACTGGCACGGGTGGCTGG + Intergenic
1079921223 11:26436576-26436598 AACACACTGGCAGGGGTGGCTGG + Intronic
1081817360 11:45955718-45955740 AAAACATTGGTGGTGGTGGAGGG + Intronic
1081984523 11:47291950-47291972 AGATCACTGGTGGGTAGGGCAGG + Intronic
1082938635 11:58680399-58680421 AAAACCCTGGTGGAGATGGCTGG - Intronic
1083477490 11:62923555-62923577 GATACAGTGGTGGGGGTGGCGGG - Intergenic
1083806894 11:65079684-65079706 GGAGTGCTGGTGGGGGTGGCAGG + Exonic
1084973605 11:72784486-72784508 ATATAACTGGTGGGGGTGACTGG + Intronic
1085880568 11:80462894-80462916 AAAACACCGGTAGGGGTAGCCGG - Intergenic
1086089446 11:82991031-82991053 AGGACACTGATGAGGGTGTCAGG + Intronic
1086741928 11:90379527-90379549 AGAACATAGGCGGGGCTGGCTGG + Intergenic
1086801637 11:91183741-91183763 AGAACATCTTTGGGGGTGGCTGG + Intergenic
1086839461 11:91667210-91667232 AAAACACTGGTGAGGGTAGTTGG - Intergenic
1086942204 11:92809906-92809928 AGGCCACTGACGGGGGTGGCAGG + Exonic
1087037364 11:93768797-93768819 TGAACTCTGGGGGAGGTGGCAGG + Intronic
1087328992 11:96755789-96755811 AGAATACTTGTGGGGGTGGCCGG + Intergenic
1087626702 11:100603989-100604011 AGAATACAGGTAGGGGTGGCTGG - Intergenic
1088729763 11:112670657-112670679 AACGCACTGGAGGGGGTGGCTGG - Intergenic
1088759419 11:112915124-112915146 AGAACACTGGTGTGAGTATCTGG - Intergenic
1089387712 11:118079072-118079094 GGAACACTGGTGGAGGGGTCAGG + Intronic
1089502739 11:118941805-118941827 AGAACACAGTGGGGGGTGGGAGG - Intronic
1090242116 11:125191499-125191521 AAGAAAGTGGTGGGGGTGGCGGG + Intronic
1090306611 11:125696752-125696774 ATAATCCAGGTGGGGGTGGCAGG - Intergenic
1090672643 11:128959921-128959943 AGAACACTGGAGGAGCTTGCAGG - Intergenic
1090748917 11:129729084-129729106 AGGACACTGGTGGGGATGGAGGG + Intergenic
1202822717 11_KI270721v1_random:76141-76163 AGAGCTCTGGTGGAGCTGGCGGG + Intergenic
1092373213 12:7934330-7934352 AGCCCACTGGTGGTGGTGGAGGG + Intronic
1092579110 12:9820131-9820153 AACACACTGGTGAGGGTGGCTGG - Intergenic
1092619922 12:10252784-10252806 AGAAGAATGGTGGGGGTGGTAGG + Intergenic
1092670798 12:10858606-10858628 AGTAGACTGGTGGGGGCGGTGGG + Intronic
1092761167 12:11812637-11812659 AGAATACTGAGGGCGGTGGCGGG - Intronic
1093690470 12:22103023-22103045 AAAACACCAGTGGGGGTGACAGG + Intronic
1095682879 12:44999331-44999353 AGAACAGTCGTGGTGGTGGTGGG - Intergenic
1095824419 12:46516517-46516539 AGAGCTCAGGTGGGAGTGGCTGG + Intergenic
1096180264 12:49546771-49546793 AGGACACAGGGGAGGGTGGCAGG - Intronic
1096766683 12:53896745-53896767 ACAACAGTGGTGGGTGTGGAAGG + Intergenic
1096806912 12:54146574-54146596 AGATCACCAGTGGGGGTGGGGGG - Intergenic
1096865319 12:54559252-54559274 AGAAAAGGGGTGGGGGTGGGTGG - Intronic
1097171056 12:57113004-57113026 AGAGCAGGGGTGGAGGTGGCAGG + Intronic
1097294742 12:57950290-57950312 AGCACAGCGGTGGGGGTGGTAGG - Intronic
1097582973 12:61481148-61481170 AGAACACTGGTGGGGACGGCTGG - Intergenic
1097890555 12:64773290-64773312 AGAACACTGGCAGGGGTGGCTGG - Intergenic
1097969982 12:65623119-65623141 AGTACTCTGGTTGGGGTGTCAGG - Intergenic
1098128355 12:67322952-67322974 AGAACACTGGCAGGGGTGGCTGG - Intergenic
1098145165 12:67490143-67490165 AACACACTGGTGGGAGTGGCTGG - Intergenic
1098658790 12:73067758-73067780 AGAACACCGGTGGGGTTGCCTGG + Intergenic
1098658842 12:73068020-73068042 AGAACACTGGTGAAGGTGGTAGG + Intergenic
1098674015 12:73266378-73266400 AGAACACAGATGGGGGTGGCTGG - Intergenic
1099667857 12:85654146-85654168 AAAACACCATTGGGGGTGGCTGG + Intergenic
1100411305 12:94322340-94322362 AAAACACTGGTGCAGGTGGCTGG + Intronic
1102026637 12:109717526-109717548 AGAAGACTGTTCTGGGTGGCCGG + Intronic
1103059403 12:117846886-117846908 ATAACAGTGGTGGGGAAGGCTGG - Intronic
1103535054 12:121628239-121628261 AGCTCACTGGTGGCGGGGGCAGG - Intronic
1104464613 12:128980209-128980231 ACGTCACAGGTGGGGGTGGCTGG + Intronic
1104683490 12:130768583-130768605 AGAAGACTTGTGAGGGTGGTGGG + Intergenic
1105782291 13:23715649-23715671 AGAATACTGGCGGGGGTGGGGGG + Intergenic
1106062395 13:26307153-26307175 AGAACATGGTTGGGGGTGGTGGG - Intronic
1106586212 13:31058484-31058506 AGCACACAGGTTGGGGTGGCTGG + Intergenic
1106868395 13:33992293-33992315 AGAACTCTGCTGGGGGGAGCTGG + Intergenic
1108483253 13:50897294-50897316 AGAGTAGTGGTGGAGGTGGCAGG + Intergenic
1108795351 13:54023766-54023788 AACACACTGGTGAGGGTGGCTGG - Intergenic
1109571225 13:64192745-64192767 TGAACACGGGTCGGGGGGGCGGG - Intergenic
1109896276 13:68695801-68695823 GGAATACTGGTGAGGGTGGTTGG + Intergenic
1109903731 13:68809606-68809628 AGAACACTGGTGGGTAAGACTGG + Intergenic
1110035145 13:70673220-70673242 AGAACACCGATGGGGGTGGCTGG + Intergenic
1111570715 13:90080989-90081011 AGAATGCTGGTGAAGGTGGCCGG - Intergenic
1112465597 13:99642066-99642088 AGAACACTTGTGAGGGTACCAGG + Intronic
1113083362 13:106540304-106540326 AGACCATTGGCGGGGGTGGGGGG + Intergenic
1113382744 13:109818496-109818518 TGGACACTGGTGGGGGGGGGGGG + Intergenic
1113433718 13:110272489-110272511 AGATCACCTGTGGGCGTGGCAGG + Intronic
1113904280 13:113812043-113812065 GGCACACTGGTGAGGGAGGCTGG + Exonic
1113911220 13:113842276-113842298 AGAACACTTGTGGGTGTGGACGG + Intronic
1115842980 14:37492865-37492887 TCACAACTGGTGGGGGTGGCGGG - Intronic
1115967736 14:38911511-38911533 AGAACACTAGTGAGGGTGGCTGG - Intergenic
1115967784 14:38911778-38911800 AGAACACTGGTGGAGGTGGCTGG - Intergenic
1116023786 14:39491883-39491905 AGCACACTGGTGGGTTTGGAGGG - Intergenic
1116027921 14:39537056-39537078 AAAACACCAGTGGGGGTGACTGG - Intergenic
1116493715 14:45536319-45536341 AGAACATGGGTTGGGGTGGCTGG + Intergenic
1116493759 14:45536557-45536579 AGAATACAGGTGGGGATAGCTGG + Intergenic
1116932261 14:50702328-50702350 ACAGCACTGGTGGGGGTGGCTGG + Intergenic
1117549649 14:56821439-56821461 AGAACAGTGGTGGGGCATGCTGG + Intergenic
1118371806 14:65144004-65144026 AGAAACCTGGTGGGGGAAGCTGG + Intergenic
1118527422 14:66661709-66661731 AGAATACAAGTGAGGGTGGCTGG - Intronic
1119669072 14:76505183-76505205 AGAACAATGGAGGGGTTGGCTGG - Intergenic
1119886293 14:78145720-78145742 ATAACAGTGGTTGGAGTGGCAGG - Intergenic
1120637906 14:86974293-86974315 AGAACACAGGTGGGGTGGGATGG - Intergenic
1121627690 14:95398649-95398671 AGCACACTGGCCGGGGAGGCAGG - Intergenic
1122026210 14:98879243-98879265 AGAGGACTGCTGGGGGTGACAGG + Intergenic
1122300512 14:100728587-100728609 AGAAAACTGGTGGGGCGAGCTGG + Intronic
1122846750 14:104504391-104504413 AGAAAGCTGGGAGGGGTGGCCGG + Intronic
1123019828 14:105392431-105392453 AGGACCCTTGTGGGGGTGACTGG + Intronic
1123426626 15:20176305-20176327 ACTACGCTGGTGGGGGTGGCTGG - Intergenic
1123496851 15:20834832-20834854 GGAACACTGGTGGGTGTAGCTGG + Intergenic
1123535857 15:21182832-21182854 ACTACGCTGGTGGGGGTGGCTGG - Intergenic
1123554083 15:21408424-21408446 GGAACACTGGTGGGTGTAGCTGG + Intergenic
1123590330 15:21845789-21845811 GGAACACTGGTGGGTGTAGCTGG + Intergenic
1123713145 15:23005718-23005740 AAAGCACTGGCAGGGGTGGCAGG + Intronic
1123971109 15:25508647-25508669 AGAATAAAGGTGGGGGTGGGGGG - Intergenic
1124092834 15:26622656-26622678 AGAATACTGGAGGGGTTGTCAGG - Intronic
1124653003 15:31486665-31486687 AGCACACTGGTGGGTGGAGCTGG - Intronic
1124784784 15:32669405-32669427 AGAACTGTGGTGGTGGTGGTTGG - Intronic
1125187826 15:36952227-36952249 AAAACACTGGTTGGGGTGGGAGG + Intronic
1126122949 15:45269741-45269763 GGGGCAGTGGTGGGGGTGGCAGG - Intronic
1126225333 15:46262717-46262739 AGAACACTGGTAGGGGTAGCTGG + Intergenic
1127029914 15:54850718-54850740 AGATCAATGGTGGAGGTGGCAGG + Intergenic
1128662687 15:69513718-69513740 ACAAGACTGTGGGGGGTGGCGGG + Intergenic
1128753437 15:70165126-70165148 AGAACACTGGACGGGGAGTCGGG - Intergenic
1129155399 15:73714279-73714301 AGCACCATGGTGGGGGTGGGGGG - Exonic
1129161092 15:73748386-73748408 ACAAGACTGTTGGGGGTGGGGGG - Intronic
1129398455 15:75266118-75266140 AGGTCACTGCTGGGGGTGCCAGG - Exonic
1129402063 15:75290394-75290416 AGGTCACTGCTGGGGGTGCCAGG - Exonic
1129475598 15:75782833-75782855 AGGTCACTGCTGGGGGTGCCGGG - Intergenic
1129971412 15:79780822-79780844 AGAACATGGCTGGGGGTAGCTGG - Intergenic
1130620167 15:85453805-85453827 AGAGCTTGGGTGGGGGTGGCTGG + Intronic
1130852165 15:87805386-87805408 AGAACCTTGGTGGGGATTGCTGG + Intergenic
1132347310 15:101116129-101116151 AGAACAGTGGTGGGGGAAGGAGG - Intergenic
1202962431 15_KI270727v1_random:135620-135642 GGAACACTGGTGGGTGTAGCTGG + Intergenic
1132500313 16:281973-281995 AGGAGCCTGGTGGGGGTGGGGGG + Intronic
1133368694 16:5231582-5231604 AGAGCTCTGGTGGAGGTGGTGGG - Intergenic
1133879876 16:9771554-9771576 AGAACTAAGGTGGGGGTGGGGGG - Intronic
1134160978 16:11889305-11889327 AGAAGAGGGGTGGGGGTGCCGGG - Intronic
1135007055 16:18835121-18835143 GACACACTGTTGGGGGTGGCTGG + Exonic
1136692033 16:32039406-32039428 AGGACACTGGGGGGGGGGGGGGG + Intergenic
1136857618 16:33673200-33673222 ACTACGTTGGTGGGGGTGGCTGG + Intergenic
1137515638 16:49141087-49141109 AGAACACTGGGGTGGGAGGGAGG - Intergenic
1137892105 16:52173609-52173631 AGAATACTGGTGGTGGAGGTTGG + Intergenic
1137892475 16:52176985-52177007 ATAACCATGGTGGGGATGGCTGG + Intergenic
1138071290 16:53995543-53995565 ATAACACTGGTGTGGCTGCCAGG - Intronic
1138124727 16:54429408-54429430 AGAAAACTTGTGGGGATGCCAGG + Intergenic
1138761773 16:59552812-59552834 AGAACACTCGGGAGGGTGGGGGG - Intergenic
1138906452 16:61340816-61340838 AGTGCTCTGGTGGGAGTGGCAGG + Intergenic
1139065556 16:63309203-63309225 AAAAAAAAGGTGGGGGTGGCTGG + Intergenic
1139504769 16:67393331-67393353 AGGATACTGATTGGGGTGGCGGG + Intronic
1139960767 16:70716143-70716165 AAAACACTGGGGGAGGTGGAGGG - Intronic
1141469308 16:84228040-84228062 TGAACACTCCTGGGGGAGGCAGG + Intronic
1141999336 16:87655197-87655219 AGGGCCCTGGCGGGGGTGGCGGG - Intronic
1142073051 16:88101936-88101958 AGGATCCTGGTGAGGGTGGCAGG + Intronic
1142168384 16:88606007-88606029 AGGACACTGTTGGTGTTGGCTGG + Intronic
1142234953 16:88917744-88917766 ATGACACTGCTGGGGGTTGCTGG - Intronic
1203119197 16_KI270728v1_random:1521683-1521705 ACTACGTTGGTGGGGGTGGCTGG + Intergenic
1142567019 17:846857-846879 AGAAAAATGGTGGGGGTGGAGGG + Intronic
1142610863 17:1108751-1108773 AGGACACCGGTCGGGGAGGCAGG + Intronic
1142730978 17:1857520-1857542 AGAAGAGAGGTGGGGGTGGAGGG - Intronic
1146370701 17:32264303-32264325 AGAACACTGTCCAGGGTGGCTGG + Intergenic
1147449697 17:40496303-40496325 AGAACACTGGGGTGGCAGGCTGG + Exonic
1147780094 17:42934892-42934914 AGAACACTGGAGGGGTGGGCAGG - Intergenic
1149453887 17:56771706-56771728 ACAACACTGGAGAGGGAGGCAGG + Intergenic
1150389809 17:64783769-64783791 AGAACAGAGGTGGCGGTGGCAGG - Intergenic
1150467084 17:65403067-65403089 GGGACATTGGTGGGGGTGGGGGG - Intergenic
1150624756 17:66834924-66834946 AGCACCCTTGTGGGGGTGGCAGG - Intergenic
1150632402 17:66889300-66889322 AGGTCACTGGTGGGGCTGGGAGG - Intergenic
1153543951 18:6186633-6186655 AGGCCACTGGTGGAGGTGGAGGG + Intronic
1153636410 18:7117331-7117353 CGAGCAGTGCTGGGGGTGGCGGG - Intronic
1154181518 18:12143458-12143480 AGAACACTGGCAAGGGTGGCTGG + Intergenic
1154181975 18:12145948-12145970 GGAACACTGGTGCGGGTGGCTGG - Intergenic
1154182386 18:12148126-12148148 AGAACACTGGCAAGGGTGGCTGG - Intergenic
1154454865 18:14511205-14511227 GGAACACTGGTGGGTGTAGCTGG + Intronic
1155091375 18:22514915-22514937 AGAACACCAGCAGGGGTGGCTGG + Intergenic
1155091422 18:22515171-22515193 AGAAGACTAGTGGAGGTGGCTGG + Intergenic
1156144436 18:34159137-34159159 GCAACGCTGGAGGGGGTGGCAGG + Intronic
1156294538 18:35777561-35777583 AAAACACAGGTGGGGGTTGTGGG - Intergenic
1156453104 18:37277739-37277761 AGAACACTGGGGGCTGTGCCTGG - Intronic
1156474073 18:37394735-37394757 AGCAGACTGCTGGGTGTGGCAGG - Intronic
1156618386 18:38817350-38817372 AACACACTGGTGGTGGTGGCAGG + Intergenic
1156700024 18:39814889-39814911 AGAACACTGGTGAGGGTGGTTGG + Intergenic
1156781518 18:40856256-40856278 AGTAGACGGGTGGGGGTGGGGGG - Intergenic
1157883246 18:51341979-51342001 AGAAAACTAGTGGTGGTGGCAGG + Intergenic
1157887526 18:51383338-51383360 GGGACAGTGGTGGGGATGGCAGG + Intergenic
1158639656 18:59192940-59192962 AAAACAGTAGTGGGGGTGGGGGG + Intergenic
1159449592 18:68583398-68583420 GGAACACTGGTAGGGGAGGGTGG + Intergenic
1159463200 18:68745934-68745956 AGAACTCAGGTGGGGATGGGGGG + Intronic
1160544041 18:79641096-79641118 AGAAAGCAGGTGGGGGTGCCGGG - Intergenic
1160568169 18:79799340-79799362 AGAACAGGGGTGGGGGAGGAGGG - Intergenic
1160928741 19:1559815-1559837 AGGACCCTGGGAGGGGTGGCGGG + Intronic
1161207282 19:3047479-3047501 AGACCCCTTGTGGGGGTGTCGGG + Intronic
1162371599 19:10283451-10283473 AAAACAGAGGTGGGGGTGTCTGG - Intronic
1163364484 19:16868470-16868492 AGGACAGTGGTGTGGGAGGCTGG + Intronic
1164526421 19:29016739-29016761 AGAAAATTGGTGGGGGTGGGGGG - Intergenic
1164684980 19:30160650-30160672 AGAACGCTGGTGGGAGTGTCAGG + Intergenic
1165046698 19:33110247-33110269 AGAACACAGCTGGCGGTGGCCGG + Intronic
1165216505 19:34277908-34277930 TGAAAACTGCTGGGGGTGGGGGG - Intronic
1165390068 19:35533735-35533757 AGCACACTGGCGGGTGTGGAGGG - Intronic
1165451601 19:35887087-35887109 AGAACATTGGTAGGGGAGACAGG + Intergenic
1165871051 19:38973480-38973502 CAAACACCAGTGGGGGTGGCAGG + Intronic
1168492478 19:56822216-56822238 AGAACACTGCTGTGGGCAGCAGG - Intronic
925633801 2:5922918-5922940 ACTACCCTGGTGGAGGTGGCTGG + Intergenic
926624601 2:15080701-15080723 GGCACCCTGGTGGGGGTGGCTGG + Intergenic
926722946 2:15975872-15975894 AAAACACTGGAGGGTGGGGCAGG - Intergenic
928083315 2:28328788-28328810 ACAACACTACTGGGTGTGGCAGG - Intronic
929071101 2:38031433-38031455 AAAGCACTGGTGGGGGAGGCTGG - Intronic
929235857 2:39605040-39605062 AGAGGACTGGTGCGGGTGGCTGG - Intergenic
929460298 2:42098439-42098461 AGGAGCCTGGTGGGGGTGGGGGG - Intergenic
930229329 2:48827448-48827470 AGAACTCTGGCAGGGGTGGCTGG - Intergenic
930585995 2:53267796-53267818 AGAATACCGGCAGGGGTGGCTGG - Intergenic
932519440 2:72394412-72394434 AGAAAAGTGGTGGGGCTTGCTGG + Intronic
932717889 2:74116025-74116047 AAAAGGCTGGAGGGGGTGGCGGG + Intergenic
932813200 2:74841466-74841488 TGAAAACTGAAGGGGGTGGCAGG - Intronic
933603888 2:84360960-84360982 AACACATTGGTAGGGGTGGCTGG - Intergenic
933982825 2:87567357-87567379 AGAACAGTGGGGGCGGTGGTGGG - Intergenic
934623318 2:95829656-95829678 AGAACACCAGTGGGGGTGGCTGG + Intergenic
934623533 2:95831197-95831219 AAAACACTGTTGCTGGTGGCTGG - Intergenic
934623710 2:95832088-95832110 AGGACACTGGGGGAGGGGGCGGG + Intergenic
934623819 2:95832524-95832546 AGAACATTGGCGGGGGTGGGGGG + Intergenic
934623860 2:95832740-95832762 AGAACACCAGTGAGGGTGGCTGG + Intergenic
934623885 2:95832843-95832865 AGAACACTGGTGGGATTGGCAGG + Intergenic
934623905 2:95832946-95832968 AGAACACCGGTGGGGGTGGCTGG + Intergenic
934623929 2:95833049-95833071 AAAACACTGGCAGGGGTGGCTGG + Intergenic
934623952 2:95833144-95833166 AGAACACCGGTGGGGGTGGCTGG + Intergenic
934623985 2:95833247-95833269 AGAACACTGGCGGGGGTAGCTGG + Intergenic
934624012 2:95833346-95833368 AGAACACTGGCGGGGGTGGCTGG + Intergenic
934624043 2:95833449-95833471 AGAACACCAGTGGGGTTGGCTGG + Intergenic
934624110 2:95833764-95833786 AGAACACTGGCGGGGGTGGCTGG + Intergenic
934624165 2:95833970-95833992 AGAACACTGGCAGGGGTGGGGGG + Intergenic
934624208 2:95834186-95834208 AGAACACTGGCGGAGGTGGCTGG + Intergenic
934624239 2:95834289-95834311 AGAACACTGGTGGAGGTGGCTGG + Intergenic
934624264 2:95834396-95834418 AGAACACCGGTGGGATTGGCTGG + Intergenic
934624306 2:95834603-95834625 GGAACACTGGCGGAGGTGGCTGG + Intergenic
934624330 2:95834706-95834728 AGAACACCGGTGGGGGTGGCTGG + Intergenic
934624354 2:95834809-95834831 AGAACACCAGCGGGGGTGGCTGG + Intergenic
934624382 2:95834912-95834934 AGAACACTGGCAGGGGTGGCTGG + Intergenic
934624425 2:95835130-95835152 AGAACACTGGTGGGGGTGGCTGG - Intergenic
934624453 2:95835233-95835255 AGAACACTGGTGAGGGTGGCTGG - Intergenic
934624482 2:95835336-95835358 AGAACACCAGCGGGGGTGGCTGG - Intergenic
934624559 2:95835646-95835668 AGAACACTGGCGGGGGTGGCTGG - Intergenic
934624585 2:95835749-95835771 AGAACACCGGTGTGGGTGGCTGG - Intergenic
934716490 2:96547557-96547579 GGAGCACAGGTGAGGGTGGCAGG - Intronic
934808996 2:97265671-97265693 AGAACACCGGTGTGGGTGGCTGG + Intergenic
934809025 2:97265774-97265796 AGAACACTGGTGGGGGTGGCTGG + Intergenic
934809055 2:97265877-97265899 AGAACACTGGTGGGGGTGGCTGG + Intergenic
934809082 2:97265980-97266002 AGAACACTGGCGAGGGTGGCTGG + Intergenic
934809106 2:97266083-97266105 AGAACACTGGCAGGGGTGGCTGG + Intergenic
934809149 2:97266289-97266311 AGAACACCAGCGGGGGTGGCTGG + Intergenic
934809179 2:97266392-97266414 AGAACGCTGGCGGGGGTGGCTGG + Intergenic
934809207 2:97266495-97266517 AGAACACTGGTGGGGGTGGCTGG + Intergenic
934809236 2:97266598-97266620 AGAACACTGGTGGGGGTGGCTGG + Intergenic
934809279 2:97266804-97266826 AGAACACCGGAGGGGGTGGCTGG - Intergenic
934809305 2:97266907-97266929 AGAACACCGGAGGGGGTGGCTGG - Intergenic
934809334 2:97267010-97267032 AGAACACTGGTGGGGGTGGCTGG - Intergenic
934809384 2:97267215-97267237 AGAACACCGGCGGGGGTGGCTGG - Intergenic
934809405 2:97267310-97267332 AAAACACTGGCAGGGGTGGCTGG - Intergenic
934809430 2:97267413-97267435 AGAACACCGGTGGGGGTGGCTGG - Intergenic
934809454 2:97267516-97267538 AGAACACCGGTGGGATTGGCTGG - Intergenic
934809477 2:97267619-97267641 AGAACACTGGCGGGGGTGGCTGG - Intergenic
934809503 2:97267729-97267751 AGAACACAGGTGAGGGTGGCCGG - Intergenic
934809541 2:97267936-97267958 AGAACACCAGTGGGGTTGGCTGG - Intergenic
934809600 2:97268142-97268164 AGAACACTGGTGGGGTTAGCTGG - Intergenic
934809622 2:97268245-97268267 AGAACACTGGCGAGGGTGGCTGG - Intergenic
934809650 2:97268348-97268370 AGAACACTGGCGGGGTTAGCTGG - Intergenic
934809672 2:97268450-97268472 AGAACACCGGTGGGGGTGGCTGG - Intergenic
934809692 2:97268545-97268567 AAAACACTGGCAGGGGTGGCTGG - Intergenic
934809717 2:97268648-97268670 AGAACACCGGTGGGGGTGGCTGG - Intergenic
934809739 2:97268751-97268773 AGAACACCAGTGGGATTGGCTGG - Intergenic
934809808 2:97269071-97269093 AGAATATTGGCGGGGGTGGGGGG - Intergenic
934809868 2:97269277-97269299 AGAACACCAGTGGGGTTGGCTGG - Intergenic
934809886 2:97269380-97269402 GGAACACCAGTGGGGGTGGCTGG - Intergenic
934809916 2:97269483-97269505 AGAATAAAGGCGGGGGTGGCCGG - Intergenic
934809993 2:97269790-97269812 AGGACACTGGCGGGGGTGGCTGG - Intergenic
934810020 2:97269893-97269915 AGAACACAGGTAGGGGTGGCCGG - Intergenic
934810217 2:97270898-97270920 AAAACACTGTTGCTGGTGGCTGG + Intergenic
934810441 2:97272435-97272457 AGAACACCAGTGGGGGTGGTTGG - Intergenic
934827251 2:97435504-97435526 AGAACACCAGTGGGGGTGGTTGG + Intergenic
934827475 2:97437041-97437063 AAAACACTGTTGCTGGTGGCTGG - Intergenic
934827672 2:97438046-97438068 AGAACACAGGTAGGGGTGGCCGG + Intergenic
934827699 2:97438149-97438171 AGGACACTGGCGGGGGTGGCTGG + Intergenic
934827776 2:97438456-97438478 AGAATAAAGGCGGGGGTGGCCGG + Intergenic
934827806 2:97438559-97438581 GGAACACCAGTGGGGGTGGCTGG + Intergenic
934827829 2:97438708-97438730 AGAACACCAGTGGGGTTGGCTGG + Intergenic
934827889 2:97438914-97438936 AGAATATTGGCGGGGGTGGGGGG + Intergenic
934827956 2:97439234-97439256 AGAACACCAGTGGGATTGGCTGG + Intergenic
934827978 2:97439337-97439359 AGAACACCGGTGGGGGTGGCTGG + Intergenic
934828022 2:97439534-97439556 AGAACACCGGTGGGGGTGGCTGG + Intergenic
934828045 2:97489642-97489664 AAAACACTGGCAGGGGTGGCTGG + Intergenic
934828066 2:97489737-97489759 AGAACACCGGCGGGGGTGGCTGG + Intergenic
934828116 2:97489942-97489964 AGAACACTGGTGGGGGTGGCTGG + Intergenic
934828145 2:97490045-97490067 AGAACACTGGAGGGGGTGGCTGG + Intergenic
934828170 2:97490148-97490170 AGAACACCGGAGGGGGTGGCTGG + Intergenic
934828196 2:97490251-97490273 GGAACACCAGCGGGGGTGGCTGG + Intergenic
934828223 2:97490354-97490376 AGAACACTGGCAGGGGTTGCTGG + Intergenic
934828269 2:97490571-97490593 AGAACACTGGTGGGGGTGGCTGG - Intergenic
934828298 2:97490674-97490696 AGAACACTGGTGGGGGTGGCTGG - Intergenic
934828326 2:97490777-97490799 AGAACGCTGGCGGGGGTGGCTGG - Intergenic
934828356 2:97490880-97490902 AGAACACCAGCGGGGGTGGCTGG - Intergenic
934828399 2:97491086-97491108 AGAACACTGGCAGGGGTGGCTGG - Intergenic
934828423 2:97491189-97491211 AGAACACTGGCGAGGGTGGCTGG - Intergenic
934828450 2:97491292-97491314 AGAACACTGGTGGGGGTGGCTGG - Intergenic
934828480 2:97491395-97491417 AGAACACTGGTGGGGGTGGCTGG - Intergenic
934828509 2:97491498-97491520 AGAACACCGGTGTGGGTGGCTGG - Intergenic
934896496 2:98124380-98124402 AGGACCCTGGTGGGGATGGCAGG + Intronic
936118822 2:109724551-109724573 AGAACACTGTTGGAGTTGGCTGG + Intergenic
936311015 2:111383436-111383458 AGAACAGTGGGGGCGGTGGTGGG + Intergenic
936862002 2:117029900-117029922 AGAACGCCAGTGGAGGTGGCTGG - Intergenic
938025238 2:127941946-127941968 AGAATGATGGTGGGGGTGGGGGG - Exonic
938282324 2:130073066-130073088 GGAATGCTGGTGGGGGTAGCTGG + Intergenic
938332954 2:130461638-130461660 GGAATGCTGGTGGGGGTAGCTGG + Exonic
938356855 2:130659033-130659055 GGAATGCTGGTGGGGGTAGCTGG - Intergenic
938433291 2:131265839-131265861 GGAATGCTGGTGGGGGTAGCTGG - Intronic
938477334 2:131628425-131628447 GGAATGCTGGTGGGGGTAGCTGG - Intergenic
940346995 2:152638389-152638411 ATAACACTGGTGGAGGTAGGAGG + Intronic
940674829 2:156714918-156714940 AGAACACTGACAGGGGTGGCTGG + Intergenic
941001766 2:160209505-160209527 AGAACCCTGGTGGTGATGGTGGG - Intronic
942075305 2:172351961-172351983 TGAGCAGGGGTGGGGGTGGCAGG - Intergenic
943612011 2:190045140-190045162 AGGACACTGGCAGGGGTGGCTGG + Intronic
943667606 2:190626576-190626598 ACAACACTCCTGTGGGTGGCAGG + Intergenic
944129925 2:196336837-196336859 GTAGCACTGGTGGGGGTGGGGGG - Intronic
944501089 2:200360895-200360917 TGAACTCTGGTGGGGGCGGGGGG - Intronic
944545509 2:200795403-200795425 AGAACCTTAGTGGGAGTGGCTGG + Intergenic
945421419 2:209641673-209641695 ATATCACTGGTAGGGGTGGGGGG + Intronic
947371321 2:229449572-229449594 AAAAAAATGGTGGGGGTGGGCGG + Intronic
947380156 2:229537355-229537377 AGGACACTGCTGGGGGTGGAAGG + Intronic
947628780 2:231638078-231638100 AGTAAACTGGTGGGGGAGGGGGG - Intergenic
947952816 2:234162669-234162691 AGCACATTGGTGGGAGGGGCAGG - Intergenic
948076797 2:235171257-235171279 TGATCACTGGTGGGGGAGGAGGG - Intergenic
948251341 2:236532287-236532309 AGCTCTCTGGTGGGAGTGGCAGG + Intergenic
948362868 2:237435119-237435141 AGAAAGCGAGTGGGGGTGGCAGG + Intergenic
1169554203 20:6732190-6732212 GGAACATTGGAGGGGGTGCCTGG + Intergenic
1169652257 20:7882566-7882588 AGAACCCTGCTGGGGGTGCAGGG - Intergenic
1170093397 20:12617498-12617520 CCAACAGTGGTGGTGGTGGCAGG - Intergenic
1170145470 20:13169183-13169205 GGAAAATTGGTAGGGGTGGCTGG + Intergenic
1170741783 20:19064991-19065013 GGAACACTGGTGGGTGGGCCAGG - Intergenic
1170780859 20:19424084-19424106 AGTAGACAAGTGGGGGTGGCTGG + Intronic
1171277558 20:23870776-23870798 AGAAGAGTGTTGGGGGTGGGGGG + Intergenic
1172041579 20:32050356-32050378 ACAACAGTGATGGGGGTGGCGGG + Intergenic
1172094579 20:32454426-32454448 AGGAGACTGCTGGGGGAGGCCGG - Intronic
1172270817 20:33654820-33654842 GGCACAATGGTGGGGATGGCAGG + Intergenic
1174387661 20:50196997-50197019 AGAACTCAGGAGGGGGTGGAAGG - Intergenic
1174592722 20:51658878-51658900 AGACCACTGGCGGGGGGGGGGGG + Intronic
1175715058 20:61249840-61249862 AGACCAGAGGTGGGCGTGGCGGG + Intergenic
1175771723 20:61628323-61628345 AGCACAGGGGTGGGGGTGCCCGG - Intronic
1175838951 20:62014572-62014594 GGGGCACTTGTGGGGGTGGCAGG + Exonic
1176819300 21:13642103-13642125 GGAACACTGGTGGGTGTAGCTGG - Intergenic
1178442819 21:32612479-32612501 AGAACCCGAGTGGGGGAGGCTGG + Exonic
1178611636 21:34087232-34087254 AGATCACTGGTGGAGGAGGGAGG + Intronic
1179550709 21:42141839-42141861 CGCCAACTGGTGGGGGTGGCTGG - Intronic
1180908521 22:19432113-19432135 CCAACCCTGGTGGGGGAGGCTGG + Exonic
1180953598 22:19731520-19731542 ACAACATTGGGGTGGGTGGCGGG + Intergenic
1181003237 22:19997825-19997847 CGGACATTGGTGGCGGTGGCTGG + Intronic
1181083793 22:20430034-20430056 ACAACACTAGTGGGGGGGCCTGG + Intronic
1182265757 22:29114049-29114071 ATAAGAATGGTGGGGGTGGGTGG - Intronic
1183259935 22:36788170-36788192 AGACCACAGGTGGTGGTGGTGGG - Intergenic
1183413121 22:37666868-37666890 ACAACAGGGGTGGAGGTGGCGGG - Exonic
1183991718 22:41601355-41601377 AGAACACTGGTGTGTGAGGCAGG - Intronic
1184024489 22:41844937-41844959 AGGACTCTTGTGGGGGTGGGGGG - Intronic
1184188148 22:42878108-42878130 ACGGCACTGGTGGGGGCGGCTGG + Intronic
1184272771 22:43394068-43394090 AGAAACATGGTGGGTGTGGCAGG + Intergenic
1184300178 22:43554023-43554045 AGAAGGCAGGTTGGGGTGGCGGG + Intronic
1184729897 22:46366306-46366328 AGGACACAGGTTGGGGTGGCAGG + Intronic
1185058533 22:48593494-48593516 ACAGGACTGATGGGGGTGGCTGG + Intronic
1185302000 22:50086385-50086407 AGAACATTGGCTGTGGTGGCTGG - Intergenic
949562501 3:5215281-5215303 AAAAAAGTGGTGGGGGTGGGGGG + Intronic
950716568 3:14851719-14851741 AGAAGTCTAGTGGGGGTGGGGGG - Intronic
950765161 3:15268036-15268058 AGAAAAATGGAAGGGGTGGCTGG - Intronic
950923328 3:16716610-16716632 AGAACACTGTCTGGGGTGCCTGG + Intergenic
950923378 3:16716882-16716904 AGAACACTGGAGAGGGTGGCTGG + Intergenic
951043695 3:18015371-18015393 AGGTCACTGGTGGGGGTGAGGGG + Intronic
951241741 3:20294709-20294731 GGGTCACTGGTGGAGGTGGCAGG + Intergenic
951363096 3:21747896-21747918 AAAACATTGATGGGGGTGGGAGG + Intronic
951640066 3:24826990-24827012 AGAACATTGGGGAGAGTGGCAGG - Intergenic
953661410 3:44894142-44894164 AGAGCCGTGGTGGGGGTGGGTGG - Intronic
953816645 3:46163484-46163506 AGAATATGGGTGAGGGTGGCTGG + Intergenic
953860040 3:46536572-46536594 AGACCACTGGTGGGGGAGTGAGG - Intronic
954686515 3:52373045-52373067 AGATCATTGGTGAGTGTGGCCGG + Exonic
955522548 3:59788741-59788763 AGAACACAGATGTGGGTGGCAGG - Intronic
957504418 3:81101160-81101182 AGGGTACTGGTGGGGGTGACTGG + Intergenic
958041544 3:88231857-88231879 AGAACAGAGGTGGTGGAGGCTGG - Intergenic
958702857 3:97615779-97615801 AGAACACAGGAGGGGGTGGCTGG - Intronic
958759578 3:98291600-98291622 AGAACATGGGTAGGGGTGGCTGG + Intergenic
959291789 3:104484634-104484656 ATAAGACTAATGGGGGTGGCTGG + Intergenic
959605457 3:108236863-108236885 AGAACACCAGTGGGGCTGGCTGG + Intergenic
960067678 3:113392399-113392421 AGAAGGGTGGTGGGTGTGGCGGG + Intronic
960342095 3:116486576-116486598 AAAACACTGGTGGGGGTGACTGG - Intronic
960502536 3:118454905-118454927 AGAATACAGATGAGGGTGGCTGG + Intergenic
960841449 3:121963281-121963303 AGAGCACTGGTGAGGGTAGCTGG - Intergenic
961042657 3:123688335-123688357 AGACCAATGGTGGGGCTGGGGGG - Intronic
961067086 3:123884560-123884582 AGAAGGCGGGTGGGCGTGGCGGG - Intergenic
961134359 3:124496269-124496291 AAAACAGGGGTGGGGGTGGGGGG - Intronic
962139363 3:132772338-132772360 AGAACATTGGTGGGGGAGGAGGG - Intergenic
963057066 3:141194412-141194434 AGAACACCGGCAGGGGTGGCTGG - Intergenic
963057122 3:141194680-141194702 AGAACACCGGTGGGGGTGGCTGG - Intergenic
963057174 3:141194950-141194972 AGAACACTGGTGAGTGTAGCTGG - Intergenic
963368670 3:144369532-144369554 AGTGCTCTGGTGGGGATGGCAGG - Intergenic
966152149 3:176877052-176877074 AACACACTGATGGGAGTGGCTGG - Intergenic
966902947 3:184500211-184500233 AGGACACAGGTGGTGGTAGCTGG - Intronic
967574820 3:191077317-191077339 AGAATACAGGTGGGGGTGGCTGG - Intergenic
967923205 3:194628044-194628066 AGAACACTGGTGGAAGAGGTGGG - Intronic
968381680 4:101761-101783 AGAATATGGGTGGGGGTGCCTGG + Intergenic
968390454 4:188186-188208 AGAATATGGGTGGGGCTGGCTGG + Intergenic
970515741 4:16828397-16828419 AGCACACTGGAGGAGGTGGAAGG - Intronic
971003780 4:22351620-22351642 AGAACACTGATGAGGGTAGCTGG - Intronic
971969839 4:33606541-33606563 AGAACACTGGTGGGGTTATCTGG - Intergenic
972022004 4:34327037-34327059 AGAATGTGGGTGGGGGTGGCCGG - Intergenic
972270082 4:37502509-37502531 AGGGTGCTGGTGGGGGTGGCAGG + Intronic
972487095 4:39552463-39552485 AGATCACTCCTGGGGTTGGCAGG - Intronic
973286958 4:48429581-48429603 AGAACACTGGGGGTGGGGGTGGG + Intergenic
973847566 4:54928417-54928439 ACAACACTGCTGGGGATGGGTGG - Intergenic
974109812 4:57512335-57512357 AAAACACTGGCAGGGGTAGCAGG + Intergenic
974184727 4:58431082-58431104 AAAGCACTGGTGGGGATGGCTGG + Intergenic
974199725 4:58622773-58622795 AGAACACTGGCAGTGGTGACTGG - Intergenic
974888460 4:67850479-67850501 ATAAAACTGCTGGGGGTGGGTGG + Intronic
974986076 4:69027154-69027176 AGAACACTGGTGGGAGTGGTTGG + Intronic
975106188 4:70571609-70571631 GTAGCTCTGGTGGGGGTGGCTGG + Intergenic
975263767 4:72336851-72336873 TTAACACTGGTGGGTGGGGCGGG - Intronic
975824018 4:78300918-78300940 GTAACAGTGGTGGGGGTGGTGGG - Intronic
976475190 4:85475296-85475318 AGGAGCCTGGCGGGGGTGGCTGG + Exonic
976622452 4:87142896-87142918 ATTACAAAGGTGGGGGTGGCTGG - Intergenic
976923763 4:90471261-90471283 AGAAAATTGGTGGGGGTTGGGGG - Intronic
977394160 4:96450862-96450884 AGAACACTGATGGTGGTGGCTGG + Intergenic
977926543 4:102706073-102706095 AGACCACTGGTCTGGATGGCTGG - Intronic
978025399 4:103867427-103867449 AGAACAGTGGTGGTGGTGGCTGG + Intergenic
978118460 4:105050053-105050075 AGAATACCAGTGGGGGTGGCCGG - Intergenic
978203406 4:106049727-106049749 ACATCCTTGGTGGGGGTGGCAGG + Intronic
978208228 4:106104984-106105006 ATAGCTCTGGTTGGGGTGGCTGG - Intronic
978238796 4:106491711-106491733 AGAACACTGGTGGGGGTAACTGG + Intergenic
978238847 4:106491981-106492003 AAAACATTGGCTGGGGTGGCTGG + Intergenic
978683879 4:111415658-111415680 AGAACACTAGCAGGGATGGCTGG + Intergenic
978916534 4:114132254-114132276 AAAACACTGGTGGAAGTGACTGG + Intergenic
979044935 4:115851498-115851520 AGACCACCGGTGAGGGTAGCTGG - Intergenic
979152766 4:117341457-117341479 AGAAAACAGGCAGGGGTGGCTGG + Intergenic
979968470 4:127106037-127106059 AGAACACTGGTGGGGGTGGCTGG - Intergenic
981086661 4:140690357-140690379 AGAACAATGTTGGAGGTGGATGG - Intronic
981954978 4:150460041-150460063 AGAACACTCTTGGGGGTGGGGGG - Intronic
982099345 4:151953151-151953173 AGAAGCCTGGTGGGGGTTGCAGG - Intergenic
982646047 4:158026544-158026566 AGAATTCTGGTGAGGTTGGCTGG - Intergenic
983391733 4:167140726-167140748 TGAACTCTGGGGGAGGTGGCAGG - Intronic
983898969 4:173113080-173113102 AAAACATCGGTGGGGGTGGCTGG - Intergenic
984615588 4:181893496-181893518 AGAGGAATGGTGGGGGTGGGGGG - Intergenic
985070682 4:186164357-186164379 AGAGCACTTGTGGGTGTGTCCGG - Intronic
985345650 4:189001868-189001890 AGAACACAGGCAGGGGTGGCTGG + Intergenic
987388348 5:17351831-17351853 AGGACAGTGGTGGGTGTGGCAGG + Intergenic
987591151 5:19928671-19928693 AGAACACTGGGAGGATTGGCAGG + Intronic
987675235 5:21064784-21064806 AGAACACTGGTGGGGGTAGCTGG + Intergenic
987704470 5:21445674-21445696 TGGACACTGTGGGGGGTGGCGGG - Intergenic
988919241 5:35925479-35925501 AGAACAGAGGTATGGGTGGCAGG + Intronic
988935901 5:36082891-36082913 AGAGCACTGGCAGGGGTGGCTGG - Intergenic
988987808 5:36637871-36637893 AGAACTCTGGGGTGGGGGGCAGG - Intronic
989423410 5:41267660-41267682 AGAGCCAGGGTGGGGGTGGCTGG - Intergenic
990359867 5:55007491-55007513 AGAACATTGGCAGGGATGGCTGG - Intronic
994235249 5:97355649-97355671 AGAACACCAGCAGGGGTGGCTGG + Intergenic
994277381 5:97855256-97855278 AGAACACCAGTGGGGGTGTCTGG - Intergenic
995329685 5:110933378-110933400 AGAACACAGGTGGGGATGGCTGG + Intergenic
996425833 5:123312893-123312915 AGAACACTGGCAGGGGTGGCTGG + Intergenic
996778614 5:127159778-127159800 AGAACACAGGTGGTGGTGGCTGG + Intergenic
996901822 5:128551643-128551665 ACAACACTGTTGCTGGTGGCCGG - Intronic
997205045 5:132043289-132043311 AGAACACTGGTGGTGGTGGCTGG + Intergenic
997205096 5:132043548-132043570 AGAACACTAGAGGAGGTGGCTGG + Intergenic
999074371 5:148780652-148780674 AGAGCACTGGCAGAGGTGGCTGG - Intergenic
999074422 5:148780921-148780943 AGAACACTGTCTGGGGTAGCTGG - Intergenic
999537102 5:152529261-152529283 AAAACACTAGGGGTGGTGGCTGG + Intergenic
999959133 5:156735430-156735452 AGAGCACTGGCAGGGGTGGCTGG + Intronic
1000981793 5:167824277-167824299 AGATCCTTGGTGGTGGTGGCAGG - Intronic
1001083168 5:168681693-168681715 AGAAGGCTGGTGTGGGTGGTAGG - Intronic
1001135469 5:169099099-169099121 AGAACACTGGGGAGAGGGGCTGG - Intronic
1001398697 5:171434100-171434122 ACAGCACTGGTGGGGCAGGCAGG + Intronic
1002358571 5:178651231-178651253 AGAACAGTCATGGGGGTGGATGG + Intergenic
1003637103 6:7842387-7842409 AGAACAGAGATGGGGGTGGGTGG - Intronic
1005599007 6:27407200-27407222 AGAACACTTGTGGGGGACGTAGG + Intergenic
1005839315 6:29731087-29731109 AGAAGATTGGTGGGAGTGGCGGG - Intronic
1005853219 6:29838489-29838511 AGAAGATTGGTGGCGGTGGTGGG - Intergenic
1006476020 6:34254725-34254747 AGAAAAATGGTGGTGGTGGAGGG - Intergenic
1006674113 6:35749812-35749834 AGATCAGCGGTGGGGGTGGAAGG + Intergenic
1006850206 6:37092853-37092875 AGAACAGTGGTGGGTGGGGATGG - Intergenic
1007215593 6:40235016-40235038 AGAACACTAGTAGGGGTGGCTGG - Intergenic
1007465345 6:42047845-42047867 AGTACACTGGCTGGGGTGGCTGG - Intronic
1008092329 6:47306880-47306902 AGAACACTACTGGGGGAGGTGGG - Intronic
1008307592 6:49923218-49923240 AGAACAGTGGTGGGAGTAGGAGG + Intergenic
1008882473 6:56394928-56394950 GCAGCACTGGTGGAGGTGGCAGG - Intergenic
1008956990 6:57226508-57226530 AGAACAGTGGTGAGGGAAGCAGG + Intergenic
1009040240 6:58167294-58167316 AGAACAGTGGTGGTGGAGGCAGG - Intergenic
1009216137 6:60922153-60922175 AGAACAGTGGTGGTGGAGGCAGG - Intergenic
1009325679 6:62345611-62345633 ACAACACCAGTGGAGGTGGCCGG - Intergenic
1009888752 6:69655817-69655839 AGAACACTGGCAGGGGTTGCTGG - Intergenic
1011137774 6:84118169-84118191 AGAACATGGGTGGGGGTGGCTGG + Intergenic
1011297676 6:85841159-85841181 AGAACACACATGGAGGTGGCTGG - Intergenic
1012616364 6:101283787-101283809 AGAACACTGGTGGGGGTGGCTGG - Intergenic
1012869431 6:104656510-104656532 AGAACATGGGTGGAAGTGGCTGG - Intergenic
1013308677 6:108873332-108873354 TGAGCTCTGGTGGGGGTGGCGGG + Intronic
1015488667 6:133800444-133800466 AAAACACTGGTGGGGGTGGCTGG + Intergenic
1016773310 6:147876060-147876082 AGAACACTGGAGGAGGAAGCGGG + Intergenic
1018391167 6:163343072-163343094 AGAAGGCTGGAGGGGGAGGCAGG + Intergenic
1019595623 7:1857059-1857081 AGCAGACTGGTGGGGCAGGCAGG + Intronic
1021401337 7:20212893-20212915 AGAATACTAGCGGGAGTGGCTGG + Intronic
1021521007 7:21538816-21538838 AGAACATGGGTGGGGGTGCCAGG + Intergenic
1021525909 7:21587549-21587571 AGGACACTGTTGGGGGTGGCTGG + Intronic
1022490670 7:30815334-30815356 AGACCACTGGGGAGGGAGGCTGG + Intronic
1023728973 7:43172144-43172166 GGCACAATGGTGGGGGTGGGGGG + Intronic
1023767204 7:43522682-43522704 AAACCACTGGTGGGGATGCCAGG + Intronic
1023886491 7:44360757-44360779 GGGACACTGGTGGGGATAGCTGG + Intergenic
1023937795 7:44751560-44751582 AGAAAGCTGGTTGGGTTGGCTGG - Intronic
1024165263 7:46723883-46723905 ATAGCCCTGGTGGGGGTGGCTGG - Intronic
1024324227 7:48096081-48096103 AGGAGGCTGGTGGGGGTGGAGGG + Intronic
1025023459 7:55497544-55497566 ACAACACTGATGGGGGGGGGGGG + Intronic
1025026297 7:55519003-55519025 AGAAGACTAGTGGGTGGGGCTGG + Intronic
1025756909 7:64352603-64352625 AGAGCGCTGGTGGTGGTAGCTGG + Exonic
1025870031 7:65422760-65422782 AGAACATCAGTGGGAGTGGCTGG - Intergenic
1026829738 7:73603364-73603386 AGACCCCAGGTGGGGGTGGCTGG + Intronic
1026844996 7:73693750-73693772 AGAACACTGGTGGGGAAGCAGGG + Intronic
1027576282 7:79934871-79934893 AGAACACAGACGAGGGTGGCTGG + Intergenic
1027627731 7:80565252-80565274 AGAAGACTGGTGGGGATAGGTGG + Intronic
1027627782 7:80565519-80565541 AGAACACTGGTGCGGGTGGCTGG + Intronic
1028426890 7:90699668-90699690 ATAACCTTGGTGGGTGTGGCAGG + Intronic
1028639855 7:93029877-93029899 GGGGCACTGGTGGGGCTGGCAGG - Intergenic
1028712103 7:93921375-93921397 AGAACACTGGTGGGTATTTCTGG + Intergenic
1029052079 7:97700047-97700069 AGAACACCTTTGGGAGTGGCTGG - Intergenic
1029655124 7:101919112-101919134 AGAACAGTGGTGGGAGTCGGGGG + Intronic
1029667198 7:102003337-102003359 AGAACAGTGGAGCGGGGGGCGGG - Intronic
1029688272 7:102163754-102163776 CCAACACTGGTGCAGGTGGCAGG + Intronic
1030122105 7:106120133-106120155 AGGAGAGGGGTGGGGGTGGCTGG - Intergenic
1030423305 7:109337633-109337655 AGAATACTGGTGGGGGATGGGGG + Intergenic
1031112910 7:117632693-117632715 AGAACACTAGTGTTGGTGGCAGG + Intronic
1033426232 7:141246868-141246890 AAAAGAGTGCTGGGGGTGGCTGG - Intronic
1034313557 7:150110679-150110701 TGATCAGTGGTGGGGCTGGCAGG + Intergenic
1034793339 7:153990117-153990139 TGATCAGTGGTGGGGCTGGCAGG - Intronic
1034839916 7:154386301-154386323 AGAAGCATGGTGGGGGTGGGGGG - Intronic
1035742355 8:1937925-1937947 AGCATACCGGTGGGGGTGGCTGG + Intronic
1037802741 8:22044167-22044189 AGCACAATGGTGCGGCTGGCCGG + Intronic
1038858653 8:31361134-31361156 TTATCACTGGTGGAGGTGGCTGG + Intergenic
1039365787 8:36926634-36926656 AGAAGTCTGGTGCGGGAGGCAGG + Intronic
1040063836 8:43128061-43128083 AGAACACTGGTGACAGTGGGTGG + Intergenic
1040087697 8:43363714-43363736 GGAACACTGGTGGGGGTAGCTGG - Intergenic
1040404808 8:47089020-47089042 AGAATACTGGTGGGGGTAGCTGG + Intergenic
1041623407 8:59999281-59999303 AGAATACAAGAGGGGGTGGCTGG - Intergenic
1041623451 8:59999524-59999546 AGAACATGAGTGGGAGTGGCTGG - Intergenic
1041972598 8:63760764-63760786 AGAACATGGGCAGGGGTGGCTGG + Intergenic
1041972697 8:63761309-63761331 AGAATGCGGGTGGGGATGGCCGG + Intergenic
1042489548 8:69381665-69381687 AGAACACAAGCAGGGGTGGCCGG - Intergenic
1042969411 8:74391635-74391657 AGAAAAGATGTGGGGGTGGCTGG - Intronic
1043191204 8:77225248-77225270 AGAACATCAGTGGAGGTGGCTGG + Intergenic
1043301876 8:78744269-78744291 AGAACACCAGCGGGGATGGCTGG + Intronic
1043301928 8:78744516-78744538 ACAACACTGCTGCTGGTGGCTGG + Intronic
1043318129 8:78946612-78946634 AGGTCACTGGTGCGGGTGACTGG + Intergenic
1043391855 8:79799346-79799368 AGAGTAGTGGTGGGGGTGGGGGG + Intergenic
1043396511 8:79842778-79842800 AGAACAGGGGCAGGGGTGGCTGG - Intergenic
1043413811 8:80028639-80028661 AGAAGACGGGCGGGGGGGGCGGG + Intronic
1044125791 8:88457039-88457061 AGAGCTTGGGTGGGGGTGGCTGG - Intergenic
1044229363 8:89757437-89757459 AGAATCCTGTTGGGGGAGGCGGG + Intergenic
1045699561 8:104850359-104850381 AAAACACTAGTGAGGGTGGCTGG + Intronic
1046506146 8:115139685-115139707 AGAATACCGGTGGGGTTGGCTGG + Intergenic
1049277648 8:141727908-141727930 AGAACACAGGCGGGAGGGGCTGG + Intergenic
1050273665 9:3973416-3973438 TTAACACTGTTGGGTGTGGCTGG + Intronic
1051150967 9:14078768-14078790 AGGACACTGGTAGAGGTGGTGGG + Intergenic
1051821996 9:21180123-21180145 AAAACAGTGGTGGAGGTGACTGG - Intergenic
1051823222 9:21192185-21192207 AAAACAGTGGTGGAGGTGACTGG - Intergenic
1051827032 9:21232785-21232807 AAAACAGTGGTGGAGGTGACTGG - Intronic
1051899825 9:22026013-22026035 AGAACACCAGTTGGGGTAGCCGG + Intronic
1051899885 9:22026286-22026308 AGAACACTGGCAGGTGTGGCTGG + Intronic
1052349261 9:27441823-27441845 AGAACACTGCTGGGGTGGGGAGG - Intronic
1052766879 9:32650614-32650636 AAAACACCAGTGGGGGTAGCTGG - Intergenic
1053315914 9:37051802-37051824 AGAACACTGGTAAGGGAGGCAGG + Intergenic
1054954218 9:70889413-70889435 AGAAAACAGGTGGGGTTGGCGGG - Intronic
1055224927 9:73984436-73984458 AGAACACCAGTGGGGGTAGCTGG - Intergenic
1056001955 9:82227348-82227370 AGAATACAGGAGGGGGTTGCTGG + Intergenic
1056002007 9:82227614-82227636 AGAACACAGGCAGGGGTGGCTGG + Intergenic
1056037501 9:82622687-82622709 ACAACCCTGGTGGGCCTGGCAGG + Intergenic
1056907567 9:90666516-90666538 AGAACACTGGTGGGAGTGGCTGG + Intergenic
1057256719 9:93555035-93555057 AGCTCAGAGGTGGGGGTGGCTGG + Intronic
1058461776 9:105190037-105190059 AGAACACTGGCGAGAGTGGCTGG + Intergenic
1058841292 9:108912064-108912086 AGGAAACTGGTGGGGGAGGGGGG + Intronic
1059394165 9:114021686-114021708 AGAAAACTGTTGGGGGTGATGGG - Intronic
1059711050 9:116868042-116868064 AGAGCACTGGGGGCGGAGGCAGG + Intronic
1059756869 9:117302078-117302100 AGAAAAGTGGTGGGGGTGGGAGG + Intronic
1061363747 9:130159582-130159604 ACAACCCTTGTGGGGGTGGGTGG + Intergenic
1062137832 9:134939017-134939039 AGCAGAGGGGTGGGGGTGGCTGG - Intergenic
1062324158 9:136004466-136004488 GGAACCATGGTGGGGGTGGGGGG - Intergenic
1062480772 9:136749978-136750000 GGGACACTAGTGGGGCTGGCAGG - Intergenic
1062697248 9:137881680-137881702 AGCACACGCGTGGGGCTGGCAGG - Intronic
1203528058 Un_GL000213v1:107467-107489 GGAACACTGGTGGGTGTAGCTGG + Intergenic
1188714875 X:33448855-33448877 AGAGCACTGGTGAGGGTGACTGG - Intergenic
1188714902 X:33449004-33449026 AGAGCACTGGTGGGGGTGGCTGG - Intergenic
1188869803 X:35359640-35359662 AGAACACTGGTGGGGGTGGCTGG + Intergenic
1189350615 X:40272985-40273007 GGAACTCTGGGGGAGGTGGCCGG - Intergenic
1189854942 X:45214601-45214623 AAAACACCAGTGGGGGTGACTGG - Intergenic
1189903593 X:45734530-45734552 ATCACACTGGTGGCGGGGGCGGG - Intergenic
1190600614 X:52088841-52088863 AGAACGCTGGTGGGGGTAGCTGG + Intergenic
1190775552 X:53549744-53549766 AAAAAGCTGGTGGGGGTGGGGGG - Intronic
1190977171 X:55416905-55416927 AGAACACCAGTGGGAGTGGCTGG - Intergenic
1191019331 X:55842697-55842719 AGAACCCTGGTGGGTGTGGCAGG + Intergenic
1191223480 X:58015988-58016010 AAAACACTGGTGGGGGTGACTGG - Intergenic
1191739047 X:64417711-64417733 AGAACACCAGTGGGTGTAGCTGG + Intergenic
1191743792 X:64464304-64464326 AGAACACTGGTTGGGGTAGCTGG + Intergenic
1191743836 X:64464581-64464603 AGAACACTGACAGGGGTGGCTGG + Intergenic
1191743871 X:64464851-64464873 AGAACACTGGCAGATGTGGCTGG + Intergenic
1191876945 X:65807074-65807096 AGAATATGGGTGGGGTTGGCTGG - Intergenic
1191988677 X:67009378-67009400 AGAACACTGGTTGGGGTGGCTGG - Intergenic
1191988762 X:67009910-67009932 AGAGCACTGGGGAGGCTGGCTGG - Intergenic
1191993828 X:67068484-67068506 AGAACACTGGTCAGGGAGGCTGG - Intergenic
1192067728 X:67904046-67904068 AACACACTGATGGGAGTGGCTGG + Intergenic
1192723486 X:73724420-73724442 AGAACATGGGTGAGGGTGCCTGG + Intergenic
1192920402 X:75700244-75700266 AGAATATAAGTGGGGGTGGCTGG - Intergenic
1192920723 X:75703116-75703138 AGAACATTGAAGGGAGTGGCTGG - Intergenic
1192926274 X:75758431-75758453 ATAACAGTGGTGGGGGTGGCTGG - Intergenic
1193005865 X:76617679-76617701 AAAACACTGGCAGGGGTGGCTGG - Intergenic
1193011981 X:76686991-76687013 ACAGCCCTGGTGGGAGTGGCAGG + Intergenic
1193295878 X:79830470-79830492 GGAAAACCGGTGGAGGTGGCTGG + Intergenic
1193301309 X:79891976-79891998 AGAACACCAGCAGGGGTGGCTGG - Intergenic
1193685322 X:84571165-84571187 AGAACAATTATGAGGGTGGCTGG + Intergenic
1193762849 X:85488923-85488945 AAAACACTGGTGGGTGTGGCTGG + Intergenic
1193805096 X:85985365-85985387 AGAACACTGGCAGGGGCTGCTGG - Intronic
1194067745 X:89283730-89283752 GTAGCTCTGGTGGGGGTGGCTGG + Intergenic
1194188706 X:90808057-90808079 AGAATACAGACGGGGGTGGCTGG + Intergenic
1194520150 X:94908968-94908990 AGAGCTCTGGCGAGGGTGGCTGG - Intergenic
1194594062 X:95836325-95836347 AGAACACTGGCGCAGGTAGCTGG + Intergenic
1194631514 X:96291388-96291410 AGAACACTTGAGGGTGTGGCTGG + Intergenic
1194854780 X:98915425-98915447 AGAACATGGGTGGGGATGGCTGG + Intergenic
1194867416 X:99086083-99086105 ACAACACTGGCAGGGGTGGCTGG - Intergenic
1194947949 X:100091335-100091357 AGAAAACTGGTGGGGGTGGCTGG - Intergenic
1195361342 X:104085897-104085919 AGAACACCAGCAGGGGTGGCTGG + Intergenic
1196152753 X:112392745-112392767 AGAACACCGATGGGGATAGCTGG + Intergenic
1196152806 X:112393015-112393037 AGAGCACTGACAGGGGTGGCTGG + Intergenic
1196241354 X:113346376-113346398 AAAACACTGGTAGGGATGGCTGG + Intergenic
1196241403 X:113346646-113346668 AAAACATTGGTGGGGGTTGCTGG + Intergenic
1196415090 X:115462976-115462998 ATAAAACTGATGGGGGTGGGGGG + Intergenic
1196582119 X:117391416-117391438 AGAGCACTGATGGGGGTGGCTGG - Intergenic
1196582219 X:117391991-117392013 AGAGCACTGGTGGGGGTAGCTGG - Intergenic
1197077014 X:122364554-122364576 AGAACAACAGTGTGGGTGGCTGG + Intergenic
1197077071 X:122364825-122364847 AGGACATTTGTGGGGGTGGCTGG + Intergenic
1197122147 X:122905908-122905930 AGAACACTGGTGGGGGTAGCTGG - Intergenic
1197122199 X:122906177-122906199 AGATCACTGGCGGGGGTGGCTGG - Intergenic
1197122253 X:122906444-122906466 AGAACACTGGCAGGGGTATCTGG - Intergenic
1197400328 X:125981453-125981475 AGAACACAGGTGAGAGTGGCTGG - Intergenic
1197400372 X:125981721-125981743 AGAATACTAGCAGGGGTGGCTGG - Intergenic
1197745708 X:129931578-129931600 AGAACCCTGTTGGGGGCGGGGGG - Intergenic
1198327328 X:135586638-135586660 AATGCAGTGGTGGGGGTGGCAGG - Intergenic
1198705449 X:139443565-139443587 AGAACACCAGTGAGGGTGGCTGG - Intergenic
1199182839 X:144878740-144878762 AAAACACTGGCGAGGGTGCCTGG - Intergenic
1199248927 X:145637619-145637641 AGAATACTGACAGGGGTGGCTGG - Intergenic
1199307163 X:146279950-146279972 AGAACACTGGCAGGGGTAGCTGG + Intergenic
1199307198 X:146280135-146280157 AGAACACTGGCAGGGGTAGCTGG + Intergenic
1199394024 X:147312740-147312762 TGAACACTGGTGGGGTTAGCTGG - Intergenic
1199478677 X:148273974-148273996 AGAACACTGGCGGGGGTGGCTGG - Intergenic
1199478731 X:148274218-148274240 AGAACACCAGTGGGGGTGGCTGG - Intergenic
1200133906 X:153865406-153865428 ATGACACTGGTGGTGTTGGCGGG + Exonic
1200235216 X:154464816-154464838 GGAGCACTCGTGGGGGCGGCTGG - Exonic
1200336276 X:155354192-155354214 AGAACACCAGTAGGGGTTGCTGG - Intergenic
1200350194 X:155487035-155487057 AGAACACCAGTAGGGGTTGCTGG + Intergenic
1200721894 Y:6617891-6617913 GTAGCTCTGGTGGGGGTGGCTGG + Intergenic
1200721985 Y:6618397-6618419 AGAACACTGGCGGGGATAGCTGG + Intergenic
1201958388 Y:19650825-19650847 AGAACACTGGCAGGGATGACTGG + Intergenic
1201958468 Y:19651371-19651393 AGAACACTGGTGTGCATGGTTGG + Intergenic
1202250337 Y:22864659-22864681 ATAACACTGGTGGTGGTAGCTGG - Intergenic
1202403326 Y:24498407-24498429 ATAACACTGGTGGTGGTAGCTGG - Intergenic
1202467453 Y:25171674-25171696 ATAACACTGGTGGTGGTAGCTGG + Intergenic