ID: 1012616369

View in Genome Browser
Species Human (GRCh38)
Location 6:101283797-101283819
Sequence TGTCAGCTAGAGAACACTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012616369_1012616376 18 Left 1012616369 6:101283797-101283819 CCACCAGTGTTCTCTAGCTGACA No data
Right 1012616376 6:101283838-101283860 GAGACTGAGCTCCCAGAGGGAGG No data
1012616369_1012616373 14 Left 1012616369 6:101283797-101283819 CCACCAGTGTTCTCTAGCTGACA No data
Right 1012616373 6:101283834-101283856 CCCTGAGACTGAGCTCCCAGAGG No data
1012616369_1012616377 19 Left 1012616369 6:101283797-101283819 CCACCAGTGTTCTCTAGCTGACA No data
Right 1012616377 6:101283839-101283861 AGACTGAGCTCCCAGAGGGAGGG No data
1012616369_1012616375 15 Left 1012616369 6:101283797-101283819 CCACCAGTGTTCTCTAGCTGACA No data
Right 1012616375 6:101283835-101283857 CCTGAGACTGAGCTCCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012616369 Original CRISPR TGTCAGCTAGAGAACACTGG TGG (reversed) Intergenic
No off target data available for this crispr