ID: 1012616373

View in Genome Browser
Species Human (GRCh38)
Location 6:101283834-101283856
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012616370_1012616373 11 Left 1012616370 6:101283800-101283822 CCAGTGTTCTCTAGCTGACAAAG No data
Right 1012616373 6:101283834-101283856 CCCTGAGACTGAGCTCCCAGAGG No data
1012616367_1012616373 16 Left 1012616367 6:101283795-101283817 CCCCACCAGTGTTCTCTAGCTGA No data
Right 1012616373 6:101283834-101283856 CCCTGAGACTGAGCTCCCAGAGG No data
1012616366_1012616373 17 Left 1012616366 6:101283794-101283816 CCCCCACCAGTGTTCTCTAGCTG No data
Right 1012616373 6:101283834-101283856 CCCTGAGACTGAGCTCCCAGAGG No data
1012616368_1012616373 15 Left 1012616368 6:101283796-101283818 CCCACCAGTGTTCTCTAGCTGAC No data
Right 1012616373 6:101283834-101283856 CCCTGAGACTGAGCTCCCAGAGG No data
1012616369_1012616373 14 Left 1012616369 6:101283797-101283819 CCACCAGTGTTCTCTAGCTGACA No data
Right 1012616373 6:101283834-101283856 CCCTGAGACTGAGCTCCCAGAGG No data
1012616364_1012616373 24 Left 1012616364 6:101283787-101283809 CCAGCCACCCCCACCAGTGTTCT 0: 14
1: 29
2: 65
3: 147
4: 456
Right 1012616373 6:101283834-101283856 CCCTGAGACTGAGCTCCCAGAGG No data
1012616365_1012616373 20 Left 1012616365 6:101283791-101283813 CCACCCCCACCAGTGTTCTCTAG No data
Right 1012616373 6:101283834-101283856 CCCTGAGACTGAGCTCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012616373 Original CRISPR CCCTGAGACTGAGCTCCCAG AGG Intergenic
No off target data available for this crispr