ID: 1012619679

View in Genome Browser
Species Human (GRCh38)
Location 6:101327056-101327078
Sequence TTGTTTCAGCATGAGGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012619677_1012619679 9 Left 1012619677 6:101327024-101327046 CCTGAGCTGGCAGTCTCAGGGTT No data
Right 1012619679 6:101327056-101327078 TTGTTTCAGCATGAGGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012619679 Original CRISPR TTGTTTCAGCATGAGGAGAA TGG Intergenic
No off target data available for this crispr