ID: 1012624740

View in Genome Browser
Species Human (GRCh38)
Location 6:101392508-101392530
Sequence CAGTTTCCCCCAGAGGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012624740_1012624746 28 Left 1012624740 6:101392508-101392530 CCAACTTCCTCTGGGGGAAACTG No data
Right 1012624746 6:101392559-101392581 GGCTGAGGATAAAATAGCAACGG No data
1012624740_1012624742 6 Left 1012624740 6:101392508-101392530 CCAACTTCCTCTGGGGGAAACTG No data
Right 1012624742 6:101392537-101392559 TCAGCTCCAGTTAATATTGTAGG No data
1012624740_1012624745 13 Left 1012624740 6:101392508-101392530 CCAACTTCCTCTGGGGGAAACTG No data
Right 1012624745 6:101392544-101392566 CAGTTAATATTGTAGGGCTGAGG No data
1012624740_1012624743 7 Left 1012624740 6:101392508-101392530 CCAACTTCCTCTGGGGGAAACTG No data
Right 1012624743 6:101392538-101392560 CAGCTCCAGTTAATATTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012624740 Original CRISPR CAGTTTCCCCCAGAGGAAGT TGG (reversed) Intergenic
No off target data available for this crispr