ID: 1012625485

View in Genome Browser
Species Human (GRCh38)
Location 6:101399686-101399708
Sequence CCACTCCCGCCTGTCTCCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 352}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012625478_1012625485 29 Left 1012625478 6:101399634-101399656 CCACAGTAGCTTGCCACGGAGAT 0: 1
1: 0
2: 0
3: 6
4: 65
Right 1012625485 6:101399686-101399708 CCACTCCCGCCTGTCTCCCCCGG 0: 1
1: 0
2: 1
3: 37
4: 352
1012625479_1012625485 16 Left 1012625479 6:101399647-101399669 CCACGGAGATGATGATGACGATG 0: 1
1: 0
2: 2
3: 29
4: 195
Right 1012625485 6:101399686-101399708 CCACTCCCGCCTGTCTCCCCCGG 0: 1
1: 0
2: 1
3: 37
4: 352
1012625477_1012625485 30 Left 1012625477 6:101399633-101399655 CCCACAGTAGCTTGCCACGGAGA 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1012625485 6:101399686-101399708 CCACTCCCGCCTGTCTCCCCCGG 0: 1
1: 0
2: 1
3: 37
4: 352

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012625485 Original CRISPR CCACTCCCGCCTGTCTCCCC CGG Intronic
900113679 1:1019940-1019962 CCCCTCCCTCCTCCCTCCCCCGG - Intergenic
900359656 1:2282464-2282486 CCACCACCGCCTGTCTTCTCAGG - Intronic
900418749 1:2546611-2546633 CCACCCCCGCCAGGCTCGCCGGG - Intergenic
900574993 1:3378670-3378692 CCTCTCTCGCCTTCCTCCCCAGG - Intronic
900596782 1:3483555-3483577 CCACACCCCCCTTGCTCCCCTGG - Intergenic
900744364 1:4351231-4351253 CCACCCCCGCCTGGCTGCTCTGG - Intergenic
901650092 1:10738265-10738287 CCATTCCCGCCTTCCTCACCTGG - Intronic
901671329 1:10857939-10857961 CCGGTCCAGCCTGTGTCCCCGGG - Intergenic
901684026 1:10933831-10933853 CCACACCCGCCCGCCTCCTCAGG - Intergenic
902985636 1:20152556-20152578 CCCCTCCCGCCCCTCTGCCCTGG + Intergenic
904627340 1:31814510-31814532 CCACTTCCACCTGGCTCTCCAGG + Exonic
904670493 1:32161261-32161283 CTAGTCCTGCCTCTCTCCCCTGG - Intronic
904927588 1:34060923-34060945 CCCCACCCACCTGTATCCCCTGG + Intronic
905227984 1:36492552-36492574 ACACCCCAGCCTCTCTCCCCAGG + Intergenic
905390338 1:37632316-37632338 CCACTCCCACCTGAATCACCAGG + Exonic
905513153 1:38540185-38540207 GCCCCCTCGCCTGTCTCCCCGGG + Intergenic
905862741 1:41361833-41361855 CCCCTCCCGCGGGCCTCCCCGGG + Intergenic
906211888 1:44016729-44016751 CACCTCCGGCCCGTCTCCCCGGG + Intronic
907646091 1:56244995-56245017 CCTCTCCCGCCTGATTGCCCTGG + Intergenic
911188113 1:94924003-94924025 CCACTCCACACTGTCTCCCCAGG + Intronic
912466801 1:109880127-109880149 CTACTCCCACCACTCTCCCCTGG - Intergenic
912777151 1:112513045-112513067 CCACTCCAGACTGTCTCACGAGG + Intronic
915022687 1:152796568-152796590 CCTCACCTGCCTCTCTCCCCAGG - Intronic
915367874 1:155325487-155325509 CCACGCCCTCCTGGCTCACCTGG - Exonic
915571343 1:156746898-156746920 CCCATCCACCCTGTCTCCCCAGG - Intronic
915950423 1:160186598-160186620 TCCCTTCTGCCTGTCTCCCCTGG + Intronic
919807937 1:201391810-201391832 ACACCCCCTCCTGTCTCCCGGGG - Intronic
920386814 1:205575440-205575462 CCATTCCTGCCTGCCACCCCAGG - Intronic
921031130 1:211336013-211336035 CCACTCCCTCCAGTCTCACCAGG - Intronic
921786235 1:219233333-219233355 TCACTCCCTCCTTTATCCCCAGG - Intergenic
1063092070 10:2874096-2874118 CCACTGCCTCCTTTTTCCCCAGG - Intergenic
1063227391 10:4028298-4028320 CCTCTCCCTCCTCTCTCCGCTGG + Intergenic
1064206606 10:13329721-13329743 CCACTGCCACCTGTGTCCCCAGG + Exonic
1065471070 10:26081678-26081700 CCACTCCTGCCTGGCACCACAGG - Intronic
1067081451 10:43214870-43214892 CCTCTCCGGGCTGTCTCCCTGGG - Intronic
1067098139 10:43315667-43315689 CCACCTCCGCCGGTCTCCCCAGG - Intergenic
1069689534 10:70340809-70340831 GCCCTCCCACCTGTCTCCCCAGG + Intronic
1070310839 10:75272744-75272766 CCTCTCCTGCCTGTCTTCTCAGG + Intergenic
1070955440 10:80460546-80460568 CCACTCACACCTGTCTCCTGAGG - Intronic
1070982782 10:80663110-80663132 CCACACGCGCCTGCCTCCCAGGG - Intergenic
1071505595 10:86229715-86229737 GCACGCCCGGCTGTCTGCCCTGG - Intronic
1071715244 10:88089114-88089136 GCGCTGCCGCCTGCCTCCCCTGG + Intergenic
1073327420 10:102650776-102650798 CAACCCCCACCTGCCTCCCCAGG - Intronic
1073373380 10:103010854-103010876 CCACTCCCCCCAGCCTCCCAGGG + Intronic
1074142741 10:110689287-110689309 TCACTCACCCCTGTGTCCCCAGG - Intronic
1075922325 10:126224098-126224120 CCTTTCCCGCATCTCTCCCCAGG - Intronic
1076150597 10:128159268-128159290 CCAGTCCCCCCTCACTCCCCTGG - Intergenic
1076266126 10:129111062-129111084 CCACCACCGACTGTGTCCCCAGG - Intergenic
1076324411 10:129609836-129609858 CCATTGCCGCCTGCCTCCCGTGG - Intronic
1076638450 10:131898775-131898797 CCACTCCCTCCTGTCTTCAGTGG + Intergenic
1076668257 10:132104976-132104998 TCCCTCCCTCCTGCCTCCCCTGG + Intronic
1076877221 10:133221849-133221871 CCACTCACGCCTGTAACCCTAGG + Intronic
1076877232 10:133221891-133221913 CCACTCACGCCTGTAACCCTAGG + Intronic
1076877243 10:133221933-133221955 CCACTCACGCCTGTAACCCTAGG + Intronic
1076877255 10:133221975-133221997 CCACTCACGCCTGTAACCCTAGG + Intronic
1077036004 11:494821-494843 CCACCCCCGCCTTCCTCCCTGGG + Intronic
1077499828 11:2904295-2904317 CCACTCCCGCCTAGATGCCCAGG - Intronic
1078069299 11:8097839-8097861 CCACTCCCGCCTGCTTCCTGGGG - Intronic
1078088389 11:8248408-8248430 CCACTCCTGCCTGGCTGCCCAGG - Intronic
1081785684 11:45745248-45745270 CCACCCTCTCCTGTCTCCCTTGG - Intergenic
1084085409 11:66852836-66852858 CCACTGCCCGCTTTCTCCCCAGG - Exonic
1084588991 11:70079341-70079363 ACCCTCGCCCCTGTCTCCCCTGG + Intronic
1085013493 11:73157588-73157610 CCACCCCCGCCTGCCCACCCCGG + Intergenic
1085218708 11:74854295-74854317 TCACTCCCTACTGTCTCCCTAGG - Intronic
1085641346 11:78195056-78195078 CCACACCGGCCTGTCACCCTTGG - Intronic
1087677641 11:101181156-101181178 CCAGTCCCTCATGTCTCCCCTGG - Intergenic
1088916353 11:114230838-114230860 CCACTCCATTCTGTCTCCCTGGG + Intronic
1089257582 11:117201967-117201989 CCACCCCTGTCTGTCTGCCCAGG + Exonic
1089270196 11:117296706-117296728 CCACTTCACCCTGTCTCTCCTGG + Intronic
1089349974 11:117816674-117816696 CCACTCCCACCCGTCTGTCCAGG + Intronic
1090270699 11:125383992-125384014 CCTCTCTGGTCTGTCTCCCCAGG - Intronic
1090375648 11:126286937-126286959 CCACTGCCGCCTGCTTCCCTTGG + Intronic
1090473123 11:126997430-126997452 CCACCCCCGCCAGAGTCCCCAGG - Intronic
1090838538 11:130471017-130471039 GTACTCCGGCGTGTCTCCCCGGG + Exonic
1091099512 11:132857933-132857955 TCACCCACACCTGTCTCCCCAGG - Intronic
1091201940 11:133787799-133787821 CCACGCCTTCCTGCCTCCCCGGG - Intergenic
1091263691 11:134253853-134253875 CTACTCCGGCCGGTCACCCCCGG + Intronic
1091680727 12:2524806-2524828 CCACTTCCGCCTGACTTCCAGGG + Intronic
1092771357 12:11899946-11899968 CCACTCCCACCTCCATCCCCAGG - Intergenic
1093578711 12:20764970-20764992 TCCCTCCCGCCTGTCCCCTCAGG + Intergenic
1093584624 12:20821120-20821142 TCCCTCCCGCCTGTCCCCTCAGG - Intronic
1095246804 12:39932863-39932885 CCACCCCCACCTTTATCCCCTGG - Intronic
1095949838 12:47775889-47775911 CCACACCTGCCCGCCTCCCCAGG - Intronic
1096657008 12:53098111-53098133 CCACCCACTCCCGTCTCCCCAGG - Intronic
1096796582 12:54081787-54081809 CCTCGCCCGCCTGTCTTCGCCGG - Intergenic
1097092458 12:56518089-56518111 CCACACCAGCCTGTCTCCATTGG + Intergenic
1097572821 12:61355452-61355474 CCACGCCCACCTGCCTCCCTGGG - Intergenic
1101826195 12:108221881-108221903 CCACTGCCACCTGTCTCACCAGG + Intronic
1101892501 12:108730470-108730492 GCTCTCCCGCCTGTCCCCACCGG - Intronic
1102197107 12:111033868-111033890 CCATCCCCGGCTGCCTCCCCCGG + Intergenic
1103465693 12:121140263-121140285 CTGCTCCCTCCTCTCTCCCCAGG - Intronic
1103567966 12:121826608-121826630 CCTCTGCTGCCTGTCACCCCAGG - Intronic
1103763287 12:123266162-123266184 CCACCACCGCCTCTGTCCCCTGG + Intronic
1104721074 12:131045513-131045535 CCACCCCCGCCTCCCTGCCCGGG + Intronic
1104933205 12:132351340-132351362 CCAGCCCAGCCTGTCTCCTCTGG + Intergenic
1106555242 13:30803495-30803517 CCACGCCCGCCCATCTCCTCTGG - Intergenic
1107966877 13:45605073-45605095 CCACTCCCACTTTTCTCCCGAGG + Intronic
1109628720 13:65014752-65014774 CCCCTACCTCCTCTCTCCCCTGG + Intergenic
1112734356 13:102400496-102400518 GCCCTCCAGCCTGCCTCCCCTGG + Intronic
1113379114 13:109786762-109786784 CCCCGCCCCCCTTTCTCCCCGGG + Intergenic
1114212461 14:20626845-20626867 ATCCTCCCGCCTGTCTCCCAAGG + Intergenic
1114221267 14:20699498-20699520 TCACTGCCACCTGTCTCCTCAGG - Exonic
1118892197 14:69919912-69919934 CCCCCCCCCCCTTTCTCCCCTGG + Intronic
1119442386 14:74637087-74637109 CCCGTCCTGCCTGTCTGCCCTGG - Intergenic
1120338534 14:83189901-83189923 CCACAGCCGCCCCTCTCCCCAGG + Intergenic
1121276028 14:92668264-92668286 CCTCTCCAGCCTGCCTCCCCAGG + Intronic
1121405561 14:93717395-93717417 CCACCCCTGCCTGGCTTCCCTGG - Intergenic
1122005108 14:98697014-98697036 CCACCCCCACCTGTGGCCCCAGG - Intergenic
1122859894 14:104577802-104577824 CCACACCCTCATCTCTCCCCGGG - Intronic
1124027574 15:25981038-25981060 TCACTCCCCTCTGTCTCTCCTGG - Intergenic
1124420667 15:29518611-29518633 CCCTTCCCGGCTGTCTACCCTGG - Intronic
1124660759 15:31549059-31549081 TCACTCCAGCCTGTGTCTCCCGG - Intronic
1125360325 15:38857957-38857979 CCCCTCCCACCTGCCTCCCTGGG + Intergenic
1125363245 15:38886929-38886951 CAACTCCCTCTTCTCTCCCCAGG - Intergenic
1125536161 15:40441876-40441898 CTACTCCCCCCTGCCGCCCCCGG - Intronic
1125767476 15:42145237-42145259 CCCTTCCCGCTTTTCTCCCCTGG - Intronic
1126577407 15:50210510-50210532 CCATTCCCGCCTGGCACCACAGG + Intronic
1126848733 15:52785151-52785173 GCACTCCTGCCTGACTCCCATGG + Intronic
1127495994 15:59512735-59512757 CGACTGCTGCCTGTCTCCTCTGG - Intronic
1127546718 15:59999765-59999787 CCTCCCCCGCCTCTCTCCCTTGG + Intergenic
1128133719 15:65247639-65247661 CCACCCCAGCCTGTCTACCCAGG + Intronic
1128332224 15:66763306-66763328 CCAGAGCCGCCAGTCTCCCCAGG - Intronic
1128579813 15:68801491-68801513 CCAATCCCACCTGTCTCCATGGG + Intronic
1129186516 15:73910656-73910678 CCACTCCCTCCTCTCTGCCCTGG + Intergenic
1129330033 15:74822439-74822461 CCACTCACGCCCCTCTCCCCAGG - Intronic
1129503323 15:76060169-76060191 GCACCCTCGCCTGGCTCCCCCGG - Intronic
1131074915 15:89489542-89489564 CCCCGCCCACCTGTCTCCCGGGG + Intronic
1131435152 15:92416323-92416345 CCCCTTCCACCTGTCTCTCCCGG - Intronic
1132150873 15:99457407-99457429 CCACCCCCGCCCCCCTCCCCAGG + Intergenic
1132225353 15:100136577-100136599 CCCCTCCTGCCTGCCTCCCAGGG - Intronic
1132703593 16:1231831-1231853 CCACCCCTGCCTGTCCCCCGGGG - Intergenic
1132704916 16:1239530-1239552 CCACCCCTGCCTGTCCCCCGGGG + Intergenic
1132707925 16:1254564-1254586 CCACCCCTGCCTGTCCCCCGGGG + Intergenic
1132870026 16:2111871-2111893 CCACTCGGGCCTGTCCCCACAGG - Exonic
1132892236 16:2210051-2210073 CCTCACCCCCCTGCCTCCCCAGG - Exonic
1132897164 16:2234504-2234526 CCCCTCCCGCCTGTGGCCCAAGG - Intronic
1133212893 16:4272924-4272946 TCTCTCCGGCCTGCCTCCCCGGG + Exonic
1133384080 16:5354763-5354785 CCACTCCCTCCAGCCTGCCCTGG - Intergenic
1133484481 16:6206167-6206189 CCTCTCTTGCCTCTCTCCCCTGG + Intronic
1134196504 16:12163246-12163268 CCAGTCCCGCCTTTCTCAGCAGG - Intronic
1134548933 16:15130390-15130412 CCACTTCCGCCTGTCGGCGCTGG - Intronic
1136139766 16:28281299-28281321 CCACCCCAGCCTGCCTCCTCCGG + Intergenic
1137668379 16:50265331-50265353 CCACTCCCTCCTGTGGCCTCTGG + Intronic
1138242224 16:55436281-55436303 CCCCTCCCTCCTCTCTCCTCTGG - Intronic
1138497249 16:57416106-57416128 CCACTCCGGCCTGTCACTCTGGG + Intergenic
1139465481 16:67151689-67151711 GCACTTCAGCCTGTCTCCCCGGG + Intergenic
1142492969 17:290430-290452 CGGCTCCTGCCTGCCTCCCCCGG + Intronic
1142612511 17:1116941-1116963 CCACTCCCTCCTGACTGCTCCGG - Intronic
1142871686 17:2825270-2825292 TCTCTCCAGCCTGTCTCCGCAGG + Intronic
1144223089 17:13117716-13117738 GCACTCCAGCCTGTCTCTTCAGG - Intergenic
1144756573 17:17683240-17683262 CCACCCCCGCCTCTCCTCCCAGG - Intronic
1145984327 17:29034918-29034940 CCCCTCCCTCCTCTCTCACCTGG - Intronic
1147456716 17:40542529-40542551 CCACTCCCCCCTAACCCCCCAGG + Intergenic
1147582037 17:41632368-41632390 TGACTCCCGCCTGCCTCCCCTGG + Intergenic
1147646670 17:42038358-42038380 CCATTCCCTCCTGTCAGCCCTGG - Intronic
1147741827 17:42674409-42674431 GCTTCCCCGCCTGTCTCCCCAGG - Exonic
1147967231 17:44199784-44199806 CCACTCCAGCCCGCCTCTCCCGG + Intronic
1148018486 17:44538834-44538856 CCACTCCCCCAAGTCTCCCGTGG - Intergenic
1148693381 17:49545506-49545528 CCCATCCATCCTGTCTCCCCCGG - Intergenic
1149154807 17:53615029-53615051 CCACTCCCTCCTTTCCACCCTGG - Intergenic
1151225448 17:72644653-72644675 CCACCCTGGCCTGTCTCCCGTGG - Intergenic
1151403426 17:73871173-73871195 CTTCTCCCTCCTGTCTGCCCTGG + Intergenic
1151963330 17:77418926-77418948 CCCCTCTCCCCTGTCTCCCAGGG + Intronic
1153501992 18:5759313-5759335 CCACTCCCTCCTGTTTTCTCCGG + Intergenic
1153949570 18:10046654-10046676 CCACTCTACCTTGTCTCCCCAGG + Intergenic
1155441276 18:25865105-25865127 CCACTCCACCCCGTATCCCCTGG + Intergenic
1157496739 18:48161923-48161945 CCCCACCCGCCCGCCTCCCCGGG + Intronic
1159780266 18:72652838-72652860 CAACTGCAGCCTGTCTCCCTGGG - Intergenic
1160169174 18:76538647-76538669 CCACTCCAGGCTGAGTCCCCAGG - Intergenic
1160233630 18:77068066-77068088 CCATCCCCTCCTGTCTGCCCAGG - Intronic
1160841317 19:1148089-1148111 TCCCTCCCGCCAGGCTCCCCAGG + Intronic
1160991279 19:1861306-1861328 CGACTCCCACCTGTCTACCCAGG - Intronic
1161439130 19:4280377-4280399 CCCCTCCACCCAGTCTCCCCAGG - Intronic
1161439888 19:4284890-4284912 CCACTCACGGCTGTTTCTCCAGG - Exonic
1161592626 19:5135654-5135676 CCACACCGGCCCCTCTCCCCAGG + Intronic
1161778550 19:6277168-6277190 CCATTCTCTCCTGTTTCCCCAGG + Intronic
1162552309 19:11364532-11364554 CCACCCCCGCCTGGCCCCCCAGG - Exonic
1163019194 19:14473591-14473613 CCGCTCCCGACGGCCTCCCCCGG - Exonic
1163825260 19:19519883-19519905 CCACTCCCTTCTGTCTGCCTGGG + Intronic
1164574323 19:29396877-29396899 CCATGCCCGCCTGTCTGCACAGG + Intergenic
1165417595 19:35704371-35704393 CCACTCCCGCGCGTCTGCCTCGG - Intergenic
1166122306 19:40693037-40693059 TAACTCCCACCCGTCTCCCCAGG - Exonic
1166387145 19:42388800-42388822 CCACTCCCACCTCCCTTCCCTGG - Intronic
1166405394 19:42518337-42518359 TCACTCCCGCCTCAATCCCCTGG - Intronic
1166550659 19:43663935-43663957 CCACTGCCAACTCTCTCCCCAGG + Intronic
1167116793 19:47493174-47493196 CCCATCCCCCGTGTCTCCCCAGG - Exonic
1167163175 19:47780674-47780696 CCACTTCTCCCTCTCTCCCCTGG + Intronic
1167571894 19:50293542-50293564 CCACGCCTTCCTGTCTCCCTAGG + Exonic
1167738710 19:51311765-51311787 CCCCTCCCCCCTCTCCCCCCAGG + Intergenic
1167791762 19:51687939-51687961 CCACCCCTTCCTCTCTCCCCAGG + Intergenic
1167924900 19:52813463-52813485 CCACCCCCGCCCGCCTACCCTGG - Intronic
926585032 2:14676069-14676091 CCACTCCTCCCAGTTTCCCCAGG - Intergenic
927698077 2:25251280-25251302 GCACTCCTGCCTTCCTCCCCAGG + Intronic
927937217 2:27082780-27082802 GGCCTCCCGCCTGTCTCGCCTGG + Exonic
928700278 2:33891948-33891970 CCACACCTGCCTGCCTTCCCAGG + Intergenic
930971860 2:57406150-57406172 CCACTCCTGCCTGCCTTTCCAGG + Intergenic
932178003 2:69620286-69620308 CCATTCCCTCCTGTCTCCTCTGG + Intronic
934735526 2:96687973-96687995 CCACCCCCGCGTGCCTGCCCTGG - Intergenic
937281773 2:120722305-120722327 ACACTCCTGCCTGGCTCCCCGGG + Intergenic
939129707 2:138220101-138220123 CCACAGCCTCATGTCTCCCCTGG - Intergenic
939990992 2:148876375-148876397 CCTCTCACGCCTGGCTGCCCTGG + Intronic
940987586 2:160063782-160063804 CCTCTGCAGCCTGTTTCCCCCGG - Intergenic
941850904 2:170179066-170179088 CCAGTCCTGAGTGTCTCCCCTGG + Intronic
944207756 2:197174611-197174633 CCCTCCCCGCCTCTCTCCCCAGG - Intronic
944433354 2:199660160-199660182 CCATTGCCACCTGTGTCCCCAGG - Intergenic
946013784 2:216588006-216588028 CCACCCCCGACTGTCTCCCTGGG + Intergenic
946162044 2:217841302-217841324 CCACTCCCTGCTGGCTCCCCTGG - Intronic
946399450 2:219460888-219460910 CCACCCCAGCGTGGCTCCCCAGG - Intronic
946878989 2:224158986-224159008 GCACTCACCCCTGTCTCCCCAGG + Intergenic
947911379 2:233803071-233803093 CCACTCCTGACTCTCTCCACAGG - Intronic
947916666 2:233836619-233836641 TCATTCCCGCCTGCCGCCCCAGG - Intronic
948591715 2:239054626-239054648 CCACTGCCGGCTGCTTCCCCAGG - Intronic
948752409 2:240140186-240140208 CCCCTCCCGCATGCATCCCCAGG - Intronic
948754297 2:240150238-240150260 CCACCCCTCCCTGTCTCCCCTGG + Intergenic
948786470 2:240355444-240355466 CCATGCCTGCCTGTGTCCCCAGG + Intergenic
948807672 2:240459962-240459984 TCCCTCCCTCCTGTCTGCCCAGG - Intronic
948831962 2:240602645-240602667 CCACTCCCGCCAGGCTCCTGGGG + Intronic
948831973 2:240602676-240602698 CCACTCCCGCCAGGCTCCTGGGG + Intronic
948831985 2:240602708-240602730 CCACTCCCGCCAGGCTCCTGGGG + Intronic
948832008 2:240602771-240602793 CCACTCCCGCCAGGCTCCTGGGG + Intronic
1169111230 20:3035563-3035585 CCTCTCCAACCTGTCTCTCCAGG + Exonic
1170245850 20:14220640-14220662 CCATTCCTGCCTGGCACCCCAGG - Intronic
1170314958 20:15031867-15031889 GGACTCGCGCCTTTCTCCCCAGG + Intronic
1171482493 20:25464614-25464636 CCACAGCCGCCTGCCTCCCGGGG + Intronic
1172092821 20:32446016-32446038 CCACTCGGCCCTGGCTCCCCTGG + Exonic
1173733099 20:45342013-45342035 CCCCTCCTGGCTGTCTCCACCGG - Intronic
1174804734 20:53594629-53594651 CCCCTCCCTCCGGCCTCCCCGGG - Intronic
1175167244 20:57053621-57053643 CCACTCCCTGCTGTCACACCTGG - Intergenic
1175281183 20:57805050-57805072 CCTCTCCCGCCTCTCTTCCCTGG + Intergenic
1175318563 20:58069620-58069642 CAAGTCCTGCCTGTCTGCCCAGG + Intergenic
1175611402 20:60354259-60354281 TCCCTCCTGCCAGTCTCCCCAGG - Intergenic
1175904351 20:62372249-62372271 CCCATTCCGCCTGTTTCCCCTGG - Intergenic
1176077408 20:63254629-63254651 CCACCCCCGCCTGCGGCCCCTGG + Intronic
1176305994 21:5123445-5123467 CCACCCCAGCCTGTCGTCCCCGG - Intronic
1178059284 21:28834526-28834548 CCATTCCTGCCTGTCACCACAGG + Intergenic
1178373206 21:32044698-32044720 CCATGGCCACCTGTCTCCCCCGG + Intergenic
1178992182 21:37366150-37366172 CCGCGCTCGCCTCTCTCCCCGGG - Intronic
1179183693 21:39066963-39066985 CCTCTCCTGCCTTTCTCCACAGG + Intergenic
1179729367 21:43359001-43359023 CCACTCCCATCCCTCTCCCCAGG - Intergenic
1179802825 21:43819495-43819517 CCCCCCCCTCCTCTCTCCCCTGG - Intergenic
1179851063 21:44138586-44138608 CCACCCCAGCCTGTCGTCCCCGG + Intronic
1180190838 21:46161785-46161807 CCCCGCCCGCCTGGGTCCCCGGG + Intronic
1181063428 22:20293160-20293182 CAACTCCCACCTGGATCCCCTGG + Intergenic
1182063942 22:27417244-27417266 TGACTCCCTCCTGCCTCCCCAGG + Intergenic
1182082212 22:27537611-27537633 CCCTTCCTTCCTGTCTCCCCAGG + Intergenic
1182468603 22:30533130-30533152 CCCCTCCCGCATGGCTGCCCTGG + Intronic
1182825618 22:33262428-33262450 CCTCTCTAGCCTGTGTCCCCTGG - Intronic
1182900798 22:33896706-33896728 CCACTCCCGGCTCCCACCCCTGG + Intronic
1183063773 22:35350225-35350247 CCTCTCCCTCCTGGCTCCCCTGG + Intergenic
1183236046 22:36618401-36618423 CAGCTGCCACCTGTCTCCCCAGG - Intronic
1183403824 22:37620148-37620170 CCACACCCTACTGCCTCCCCAGG - Intronic
1183443655 22:37838471-37838493 CTACTCCCTCCTCCCTCCCCAGG + Intronic
1183714691 22:39526867-39526889 CCACTCCTGCCTGGCCCCCTTGG + Intergenic
1184280879 22:43436732-43436754 CGACTCCAGCCTCTCTGCCCTGG - Intronic
1184399914 22:44267788-44267810 CCACTCCCCACTTCCTCCCCTGG + Intronic
1184911776 22:47540124-47540146 CCATTCTCTCCTGTCTCCCCAGG + Intergenic
950637204 3:14323620-14323642 CCAGCCCCGCCTGCCTCCCGGGG - Intergenic
953381761 3:42477577-42477599 CCACTCCACCCTCTCTTCCCCGG - Intergenic
954538971 3:51381400-51381422 CCACCCCCGCCTGCCGGCCCTGG + Exonic
960586542 3:119325576-119325598 CCCCTCCACCCTTTCTCCCCTGG - Intronic
960955100 3:123026391-123026413 CCACTCCCGCCTGGCGCGGCGGG + Intronic
961609314 3:128123930-128123952 CCACTTCCGTCTGTGTCTCCGGG + Intronic
961683275 3:128613052-128613074 CCACTCCCGACTGTATCCCCAGG + Intergenic
962736160 3:138327473-138327495 CCACTCTTGCCTGGCTCCCAGGG - Intronic
962920341 3:139944558-139944580 CCATTGCCACCTGTCTCCCAGGG + Intronic
963120082 3:141768990-141769012 TCACTCCCTTCTCTCTCCCCAGG + Intergenic
963939720 3:151086372-151086394 CCGCCCCCGCCTCTCTTCCCCGG - Intronic
964160558 3:153640611-153640633 CCATTCCTGCCTGGCACCCCAGG + Intergenic
966647845 3:182267016-182267038 CCAGTGCTGCCTGTCTCCCATGG + Intergenic
966903239 3:184502662-184502684 CCACACCCCTCTGTCTCCTCTGG - Intronic
966903255 3:184502752-184502774 CCACACCCCTCTGTCTCCTCTGG - Intronic
966903272 3:184502842-184502864 CCACACCCCTCTGTCTCCTCTGG - Intronic
966919141 3:184601212-184601234 CCACCCCCGCCTCACTCGCCAGG + Intronic
967035174 3:185643641-185643663 CACCTACCGCCTGTCTGCCCAGG + Intergenic
967913140 3:194558452-194558474 TTACTCCCTGCTGTCTCCCCAGG + Intergenic
968518789 4:1026454-1026476 CCATCCCCGCCTCTGTCCCCTGG + Exonic
968657755 4:1785947-1785969 CCACGCCTGCCTGCCTCCCCCGG - Intergenic
969435014 4:7184161-7184183 CCACTCCCAGCTGTGTCCTCCGG - Intergenic
969491156 4:7499922-7499944 CCCCAGCCGCCTGCCTCCCCTGG - Intronic
971331045 4:25681620-25681642 ATACTCCTGTCTGTCTCCCCAGG + Intergenic
972219369 4:36936161-36936183 CCACAGCCGCCTCTTTCCCCTGG - Intergenic
975371892 4:73599092-73599114 CTACTCCCTCCTGTGTCCCCAGG + Intronic
975855878 4:78623867-78623889 CCCCTCCCACCTTTCCCCCCAGG - Intergenic
976710015 4:88060023-88060045 CCTCTCCATCCTGTCTCCCGAGG - Intronic
977254494 4:94725852-94725874 CCTCTCCCCCCTGACTCCCTTGG + Intergenic
977728576 4:100325470-100325492 CCATTCCCACCCCTCTCCCCAGG - Intergenic
978534464 4:109746283-109746305 CCATCCCTGCCTGTGTCCCCTGG - Exonic
979810569 4:125030960-125030982 CTACTCGCACCTGACTCCCCTGG + Intergenic
981081795 4:140644299-140644321 CCACTCCCTGCTGTCCACCCCGG - Intronic
982202874 4:152975931-152975953 CCACTGCCCCCTGGCTCCGCCGG - Exonic
982494816 4:156077572-156077594 CCACTCCGGCCTGTGGCTCCTGG + Intergenic
984527639 4:180875865-180875887 CCATTCCTGCCTGGCACCCCAGG - Intergenic
985212212 4:187607235-187607257 CCACTCCCTCCCCACTCCCCTGG + Intergenic
985573664 5:663894-663916 CCACACCCGTCAGCCTCCCCAGG + Exonic
985626978 5:994150-994172 CCCCTCCCTCCTTTCTCCCCTGG - Intergenic
985727028 5:1522039-1522061 CTACTCCCTCCTGGCTCCCTGGG - Intronic
986228001 5:5835240-5835262 CATCTCCCTCCTGTCTGCCCAGG + Intergenic
988617978 5:32793755-32793777 CCACCCCCTGCTTTCTCCCCTGG + Intergenic
990724865 5:58742134-58742156 CCATGCCTACCTGTCTCCCCTGG + Intronic
992077106 5:73202017-73202039 CCTTTCCTGCCAGTCTCCCCTGG + Intergenic
996325342 5:122267086-122267108 CCACTCCTGCCTGGCACCACAGG + Intergenic
996504879 5:124257641-124257663 CCACTCCTGCCTGGCACCACAGG - Intergenic
999440947 5:151600259-151600281 CCAGTCCAGCCTGCCACCCCAGG + Intergenic
999602635 5:153283444-153283466 CCACAGCCGCCCGTTTCCCCAGG - Intergenic
1000096783 5:157978252-157978274 CCACTCACGCCTGGATGCCCAGG - Intergenic
1001544576 5:172563091-172563113 CCTCTCCTGCCTTTCTCTCCTGG - Intergenic
1002429438 5:179194500-179194522 CCACACCCGCCTCTCCCCGCAGG - Intronic
1002632514 5:180590995-180591017 CCAGACCCGCCTGTGTCCCGGGG - Intronic
1004644523 6:17546827-17546849 CTTCTCCTGCCTGACTCCCCTGG - Intronic
1004927168 6:20427143-20427165 CCACTCCTGCCTGCCTTCCCTGG + Intronic
1006581672 6:35081078-35081100 CGCCTCCTGCCTGTGTCCCCTGG - Exonic
1006635695 6:35459788-35459810 CCACTGCCACCTGTTCCCCCAGG + Intronic
1006638197 6:35474975-35474997 CCACACCTGCCTGGCACCCCTGG - Exonic
1006680733 6:35795388-35795410 CCTCTCCCACCTGCCTCCCCAGG + Intronic
1008034863 6:46735146-46735168 CCACTCCCGCCTCGCCCCCGGGG + Intronic
1010797177 6:80131066-80131088 CCTCTGCTGCCTGTCTGCCCAGG + Intronic
1011133489 6:84075245-84075267 CCACACCCACCTGACTGCCCAGG + Intronic
1012625485 6:101399686-101399708 CCACTCCCGCCTGTCTCCCCCGG + Intronic
1014214364 6:118738453-118738475 CCACTGCAGCCTCTATCCCCTGG - Intergenic
1017160717 6:151363097-151363119 CCGGTCACTCCTGTCTCCCCAGG + Intergenic
1019171457 6:170135595-170135617 CCCCTCCGACCTGTCTGCCCAGG - Intergenic
1019512061 7:1422641-1422663 TCACCCCCGCCGGTGTCCCCAGG + Intergenic
1019575461 7:1735551-1735573 CAACCCCCGCCAGCCTCCCCTGG + Intronic
1019605892 7:1910089-1910111 CCGCGCCCGCCTGTCACCCCAGG - Intronic
1019710758 7:2517170-2517192 CCACCCCCGCCCGCTTCCCCAGG - Intronic
1019731929 7:2633360-2633382 CCACTTCCGCCTCCCTCCTCTGG - Intronic
1021500963 7:21330788-21330810 TCACTCCCGGCTGTGTCCCGGGG - Intergenic
1022500817 7:30881473-30881495 CCTTTCCCTCCTGGCTCCCCAGG + Intronic
1023836957 7:44074025-44074047 CCACGCCCGCCTCTCCCCACAGG - Exonic
1024505680 7:50159306-50159328 CCCAGCCCGCCTCTCTCCCCCGG + Exonic
1025249674 7:57343542-57343564 CCAATCCCACCTCTCTCACCTGG - Intergenic
1025807853 7:64852732-64852754 CCACTGCCCCCTGTGTCCCCAGG + Intergenic
1032091918 7:128915407-128915429 CCACTCCCGCCTCTGCTCCCGGG + Intergenic
1033461455 7:141550894-141550916 CCTCTCCAGGCTCTCTCCCCTGG + Intergenic
1034438752 7:151076191-151076213 GCCCTCCCGTCTGCCTCCCCCGG + Intronic
1035064473 7:156095077-156095099 CCACTGCCTCCTGTGTTCCCTGG + Intergenic
1035671809 8:1423725-1423747 CCCCACCCGCCTCTCTCCCTTGG - Intergenic
1036297097 8:7546343-7546365 CGACTCCTGCCTGTCTCTTCCGG - Intergenic
1036325472 8:7774676-7774698 CGACTCCTGCCTGTCTCTTCCGG + Intergenic
1036490956 8:9225063-9225085 CCACACCAGCCTGTTTCCCTGGG - Intergenic
1036570429 8:9975551-9975573 CCTCTCCCACCTGCCTCCCTGGG + Intergenic
1036679934 8:10864544-10864566 GCACTCTCTCTTGTCTCCCCTGG + Intergenic
1037765683 8:21770896-21770918 CCACCCTCTCCTGCCTCCCCAGG + Intronic
1037891115 8:22624196-22624218 CCCTGCCCACCTGTCTCCCCTGG + Intronic
1041090983 8:54300363-54300385 CGCCTCCCGGATGTCTCCCCTGG - Intergenic
1042399651 8:68331084-68331106 CCACGCGCGCGTGGCTCCCCGGG + Exonic
1045367876 8:101493431-101493453 CCTCCCCCGCCTCCCTCCCCCGG + Intronic
1047309885 8:123683106-123683128 CCTCTCCCTCCTTTCTCTCCAGG - Intronic
1048162606 8:132034868-132034890 CCACCCCAGCCTGTCCCACCTGG + Intronic
1049202462 8:141347029-141347051 CCTCTGCCGCCTGTCTCTCCAGG - Intergenic
1049277646 8:141727904-141727926 CCCCTCCCGCCTGTGTTCTCCGG - Intergenic
1049379854 8:142306574-142306596 CGTCTCTTGCCTGTCTCCCCTGG - Intronic
1049762434 8:144337358-144337380 CCAGTCCCGCCTGCCTCGCTCGG + Intergenic
1053504475 9:38629879-38629901 CCACACCCACCGGGCTCCCCAGG + Intergenic
1056777235 9:89522303-89522325 AAACACCCGCCTGTCTCCCGTGG - Intergenic
1057151943 9:92803802-92803824 CCACACCCACCGGGCTCCCCGGG - Intergenic
1057188983 9:93075762-93075784 TCATACCTGCCTGTCTCCCCAGG + Exonic
1057487959 9:95500668-95500690 CCACTCCCCCTTGTCCCCCCAGG - Intronic
1057699154 9:97350263-97350285 CCTGTCCCTCCTGTGTCCCCAGG + Intronic
1057702735 9:97375586-97375608 CCACTCCACCCTGTCTCACCAGG - Exonic
1057991533 9:99775890-99775912 CCACTCTCCTCTGCCTCCCCAGG - Intergenic
1059173308 9:112146901-112146923 TGACTCACGCCTGTATCCCCAGG - Intronic
1059470156 9:114498842-114498864 CCTCGCCTGCCTGCCTCCCCTGG + Intronic
1060722850 9:125989953-125989975 CCACTCCCACCTGCTTCCCAGGG - Intergenic
1061861438 9:133470506-133470528 CCACTCTCGCCTGTGGCCCAGGG - Exonic
1062336819 9:136074898-136074920 CCATTCCCGCCAGCATCCCCCGG - Intronic
1062375208 9:136259001-136259023 CCACTCCCGTCTCACCCCCCAGG - Intergenic
1062426910 9:136510355-136510377 GCACTCCCGCCTGGCTCATCGGG - Intronic
1062515635 9:136933814-136933836 CCACTCCAGCCTGTCTCATGTGG + Intronic
1062533723 9:137012590-137012612 CCCCTCCCACCTGCCTGCCCAGG - Exonic
1062716291 9:138011867-138011889 CCAGACCCACCTGGCTCCCCTGG - Intronic
1185835849 X:3345736-3345758 CCACTCCAGGTTGTCTGCCCAGG - Intronic
1186727026 X:12368107-12368129 CCACACTCTCCTGTCTCCCAGGG - Intronic
1188005262 X:25012433-25012455 CCACCCCCGCCTGGTGCCCCAGG - Intronic
1188651026 X:32632239-32632261 CCACTCCCACCAGTTTACCCTGG - Intronic
1190322642 X:49187735-49187757 CCTCTCCCTCCTTTCTCCCCCGG + Intergenic
1191865497 X:65700406-65700428 TCACTCCAGCCTCTCTCCTCTGG + Intronic
1191884497 X:65874574-65874596 CAACCCCAGTCTGTCTCCCCTGG - Intergenic
1191979396 X:66909411-66909433 TCACTCCCCACTATCTCCCCAGG + Intergenic
1192362353 X:70447707-70447729 GCCCTCTTGCCTGTCTCCCCAGG - Intronic
1192727768 X:73769853-73769875 CCACTGCCACCTGTGTCCCCAGG - Intergenic
1198934728 X:141894761-141894783 CCACTCCTTGCTGTCACCCCTGG + Intronic
1198936033 X:141903599-141903621 CCACTCCCTGCTGTCAGCCCTGG + Intergenic
1198963529 X:142205510-142205532 CCACTCCCTGCTGACACCCCTGG - Intergenic
1200055617 X:153458598-153458620 CCACTCCCAGCTGTCCACCCAGG - Intronic
1200180159 X:154145113-154145135 CCACTCCTGGCCCTCTCCCCAGG + Intronic
1200185987 X:154183507-154183529 CCACTCCTGGCCCTCTCCCCAGG + Intergenic
1200191639 X:154220645-154220667 CCACTCCTGGCCCTCTCCCCAGG + Intronic
1200197394 X:154258449-154258471 CCACTCCTGGCCCTCTCCCCAGG + Intronic
1200256641 X:154585997-154586019 CCCCCCCAGGCTGTCTCCCCAGG - Intronic
1200261128 X:154618406-154618428 CCCCCCCAGGCTGTCTCCCCAGG + Intronic