ID: 1012625870

View in Genome Browser
Species Human (GRCh38)
Location 6:101402617-101402639
Sequence TTGTCCCAACACAGGATCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 112}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012625870_1012625875 -7 Left 1012625870 6:101402617-101402639 CCTTTGATCCTGTGTTGGGACAA 0: 1
1: 0
2: 0
3: 5
4: 112
Right 1012625875 6:101402633-101402655 GGGACAACTTGGGTTTTCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 136
1012625870_1012625880 13 Left 1012625870 6:101402617-101402639 CCTTTGATCCTGTGTTGGGACAA 0: 1
1: 0
2: 0
3: 5
4: 112
Right 1012625880 6:101402653-101402675 GGGTGCCCACCCGGCGGGCAAGG 0: 1
1: 0
2: 2
3: 7
4: 147
1012625870_1012625878 8 Left 1012625870 6:101402617-101402639 CCTTTGATCCTGTGTTGGGACAA 0: 1
1: 0
2: 0
3: 5
4: 112
Right 1012625878 6:101402648-101402670 TTCCTGGGTGCCCACCCGGCGGG No data
1012625870_1012625876 4 Left 1012625870 6:101402617-101402639 CCTTTGATCCTGTGTTGGGACAA 0: 1
1: 0
2: 0
3: 5
4: 112
Right 1012625876 6:101402644-101402666 GGTTTTCCTGGGTGCCCACCCGG 0: 1
1: 0
2: 0
3: 13
4: 167
1012625870_1012625877 7 Left 1012625870 6:101402617-101402639 CCTTTGATCCTGTGTTGGGACAA 0: 1
1: 0
2: 0
3: 5
4: 112
Right 1012625877 6:101402647-101402669 TTTCCTGGGTGCCCACCCGGCGG No data
1012625870_1012625874 -8 Left 1012625870 6:101402617-101402639 CCTTTGATCCTGTGTTGGGACAA 0: 1
1: 0
2: 0
3: 5
4: 112
Right 1012625874 6:101402632-101402654 TGGGACAACTTGGGTTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012625870 Original CRISPR TTGTCCCAACACAGGATCAA AGG (reversed) Intronic
903536779 1:24072092-24072114 TTGACCCAGCACAGGATCCTAGG - Intronic
904657629 1:32061101-32061123 TTATCCTAACAAAGGAACAAGGG + Intergenic
906917504 1:50026706-50026728 GTGTCAGAACACAGGAGCAAGGG - Intergenic
908733436 1:67250978-67251000 TTTTTCCAAAACAGGATCAGTGG + Intronic
910019324 1:82567724-82567746 TTGTCCCCAAAAAGGATAAAGGG - Intergenic
913239917 1:116821033-116821055 TTATCCCAACACAGGAGCACTGG + Intergenic
917847610 1:179034690-179034712 TAGTTCCTACTCAGGATCAAGGG + Intronic
919327399 1:196125951-196125973 TTGACATAACACAGGATAAATGG + Intergenic
921068900 1:211642869-211642891 TTCTTCCAACACAGGCTCATGGG - Intergenic
1064158991 10:12927696-12927718 TTGTCCCAAAACACGCTAAAGGG + Intronic
1064841265 10:19595127-19595149 ATGTCCCAACACTGGATGGAGGG + Intronic
1066996632 10:42570312-42570334 CTATCCAAACACAGGATCAGAGG + Intergenic
1068922230 10:62496651-62496673 TTGTTTCAACACTGGATAAATGG + Intronic
1071145113 10:82559748-82559770 TTGTCACTAAACAGTATCAATGG + Intronic
1073870131 10:107853766-107853788 GTGTCCCAATATAGGATCCAGGG - Intergenic
1073979716 10:109141199-109141221 ATGTCCCAGAACAGGTTCAAGGG + Intergenic
1075643739 10:124084291-124084313 TTGTCTCATCACAGGATGAAGGG - Intronic
1077150634 11:1071607-1071629 TTGGACCAACACAGGATGTAGGG + Intergenic
1078124650 11:8548722-8548744 TTCTCCCAATACATGATCATGGG + Intronic
1079983250 11:27174259-27174281 TTGTTCCAACACTAGATCAGAGG + Intergenic
1081738553 11:45422265-45422287 TTTTCCCAACACAGGGAAAAAGG - Intergenic
1082061233 11:47861929-47861951 TTGTCCCAGCACAGCAGCAGGGG + Intergenic
1086595869 11:88569860-88569882 TTGTCCTATCCCATGATCAAGGG + Intronic
1087956561 11:104295301-104295323 TTCTCTCCACACATGATCAAAGG + Intergenic
1091970289 12:4780880-4780902 TTGGCTCCAGACAGGATCAAAGG + Intronic
1093135894 12:15450373-15450395 TTTGGCCAACACAGGATGAAGGG - Intronic
1098375913 12:69814429-69814451 TTGTGCCAACAAAGGATTTAGGG + Intronic
1098740562 12:74169049-74169071 CTGTCCAAACACAAGATGAAAGG + Intergenic
1100932971 12:99632011-99632033 CTCTCCCATCACAGGCTCAAAGG + Intronic
1101094027 12:101317507-101317529 TTGCTCCAACCCAGGATCTACGG + Exonic
1103022875 12:117550489-117550511 CACTCCCAACACAGGATCATAGG + Intronic
1104544153 12:129696030-129696052 CTGGGCCAACACAGGTTCAAAGG + Intronic
1106130532 13:26935863-26935885 TTTTCCCATCACAGGCTCAGAGG + Intergenic
1110434571 13:75464689-75464711 TTGTGCCAATGCAAGATCAAGGG - Intronic
1113136870 13:107100414-107100436 TTATCCCAACACAGATTCCAAGG + Intergenic
1124040096 15:26093936-26093958 TTTTCCCAAAGCAGGATCTATGG + Intergenic
1129220446 15:74128989-74129011 CTGTCCCACCACAGGATCCCCGG + Exonic
1133247893 16:4461491-4461513 TTGTACCAACACAGCAGTAAGGG - Intergenic
1135207734 16:20496719-20496741 TTTTCCCAAAACAGGGTCAGTGG - Intergenic
1135211165 16:20526981-20527003 TTTTCCCAAAACAGGGTCAGTGG + Intergenic
1135374949 16:21937841-21937863 ATGGCCCATCAAAGGATCAAAGG - Intergenic
1143895961 17:10136398-10136420 TTCTCCCAACTCCGCATCAACGG + Intronic
1144093577 17:11880146-11880168 GGGTCCCAGAACAGGATCAATGG - Exonic
1144715065 17:17428336-17428358 TTTTCCCAAAACAGGGTCCATGG - Intergenic
1144751849 17:17654092-17654114 ATTTCCCATCACAGGATCAGAGG - Intergenic
1152465757 17:80465176-80465198 CTGTCCCAACACAGGAAGACGGG - Intergenic
1155670463 18:28364683-28364705 TTATCCCAAAACAGTAGCAAAGG - Intergenic
1159061570 18:63519906-63519928 GTTTCCCAACACAGGATCCTTGG - Intergenic
1160371869 18:78379002-78379024 TTGACACGACACAGGATGAATGG - Intergenic
1166307935 19:41945678-41945700 GTGTCCCAAAACAGGAACAAGGG + Intergenic
1166526355 19:43512879-43512901 CTCTCCCAACACAGGTCCAAAGG + Intronic
926457530 2:13085837-13085859 ATATCCCAAAACAGGATCACAGG - Intergenic
927247570 2:20969851-20969873 TTTTCCCAACACAGTAGCCAGGG + Intergenic
928091785 2:28379037-28379059 TTATCCCATCACCGAATCAAAGG + Intergenic
928459245 2:31455296-31455318 TTTTTCCAAAACAGGGTCAATGG + Intergenic
929935524 2:46291900-46291922 TTGTCCCAAGGCAGAGTCAAGGG - Intergenic
931101810 2:59010808-59010830 TGGTGCCAAAACAGGATCTATGG + Intergenic
931840896 2:66146849-66146871 TTGAGACAACACAGGATGAAAGG + Intergenic
931848259 2:66226945-66226967 TTCTCCCAAGAAAGGATGAATGG - Intergenic
938701490 2:133884128-133884150 TTGTGCCAACCCAGGCTCTATGG - Intergenic
940499211 2:154473853-154473875 TTTTCCCAAAACAGGCTCTATGG + Intergenic
945432493 2:209780636-209780658 TTGGCACAACTCAGGAGCAATGG - Intronic
946647131 2:221849612-221849634 TGTTCCCAACACAGGAGCAGAGG + Intergenic
947407364 2:229793120-229793142 TTCTCTCAACAGAGGATCACAGG - Exonic
947775139 2:232702648-232702670 TTGCCCCAACAGAGCATTAAAGG + Intronic
1175291768 20:57880744-57880766 GTGTCCCAACACAGGCTGACTGG - Intergenic
1178429738 21:32508801-32508823 TTGCCCCAAGTCAGGATCTAAGG + Intronic
1182072923 22:27476119-27476141 TTGTCTCACCCAAGGATCAAAGG + Intergenic
1184268333 22:43362712-43362734 TTTTGCAAACACAGGATCACAGG - Intergenic
1184460333 22:44634224-44634246 TTGTACCAAAACAGGGGCAATGG - Intergenic
1184460932 22:44637419-44637441 TTGACCCAAAACAGGGGCAATGG - Intergenic
951739467 3:25904539-25904561 TTATCCCAACACCGAAACAAAGG + Intergenic
954508535 3:51100589-51100611 TTGACCCACCACAGGAGAAATGG + Intronic
954699034 3:52442093-52442115 CTGTCCCTACCCAGGCTCAATGG + Intronic
955158124 3:56437433-56437455 TTGCCACATTACAGGATCAATGG + Intronic
965450839 3:168835924-168835946 TTGTTCCCACACAGGAACATGGG - Intergenic
967217361 3:187221882-187221904 TTACCCCCACACTGGATCAAGGG - Intronic
970328061 4:14948982-14949004 TTCTCCCACCTCAGGATCACAGG + Intergenic
979615747 4:122740421-122740443 TTATTCCACCACAGGTTCAATGG - Intronic
980742426 4:136970011-136970033 TTTTCCCAACAAAGGAAAAAGGG + Intergenic
982605363 4:157509559-157509581 TTGTCTAAACACAGCACCAATGG + Intergenic
988524138 5:31971695-31971717 TATTCCCAACACAGAAACAAAGG + Intronic
988702065 5:33685408-33685430 TTGTCCCAACTCAGGGTCTGAGG - Intronic
994244602 5:97465902-97465924 TTTTCCCAAAACAGGATTAGTGG + Intergenic
996751871 5:126896865-126896887 TTGTCCAAATACAGGTTCAAAGG - Intronic
999573664 5:152949017-152949039 TTGACCTACCACAGCATCAATGG + Intergenic
1001970474 5:175951362-175951384 TTCTCCACTCACAGGATCAAAGG + Intronic
1002246963 5:177892403-177892425 TTCTCCACTCACAGGATCAAAGG - Intergenic
1002760752 6:200116-200138 TTGTACCTAGACAGGGTCAAGGG + Intergenic
1003176772 6:3757903-3757925 CTGTCCCTTCACAAGATCAAGGG - Intergenic
1005873313 6:29993723-29993745 ACGTCCCAACACAGCATCAACGG - Intergenic
1006037436 6:31224537-31224559 ACATCCCAACACAGCATCAAAGG + Intergenic
1010104065 6:72147502-72147524 TTTTTCCAACACAGGGTCAGTGG + Intronic
1011341586 6:86321293-86321315 TTTTCCCAAAACAGGATCTGTGG - Intergenic
1012625870 6:101402617-101402639 TTGTCCCAACACAGGATCAAAGG - Intronic
1015681980 6:135818481-135818503 TTGTCCCAAACCAGAATGAAAGG + Intergenic
1021317666 7:19170032-19170054 ATGTCCCAACCCAAGTTCAATGG - Intergenic
1022356185 7:29616764-29616786 TTGTGCCACCAGAGGAACAAGGG + Intergenic
1030473381 7:109997113-109997135 TTATCCCAACAAAAGAGCAAGGG - Intergenic
1032850477 7:135790782-135790804 TGGTCCCAACACAGTCTCTAGGG + Intergenic
1034860661 7:154592145-154592167 TTATCCCACCTCTGGATCAACGG + Intronic
1038417858 8:27410369-27410391 CTGTCCCAAATCAGGATGAAAGG + Intronic
1041620931 8:59968375-59968397 TTATCCCAAGACAAGATCAGTGG + Intergenic
1046970024 8:120212545-120212567 TTGTCCCGTAACAGGATCACTGG - Exonic
1050453657 9:5810375-5810397 TTGGCCAAACACAAGAACAAGGG + Intronic
1050659645 9:7869376-7869398 TTGTAGCATCACAAGATCAAAGG + Intronic
1051918109 9:22231190-22231212 TTTTCCCAACAGATGAGCAAAGG + Intergenic
1052189330 9:25639753-25639775 TTTTACTAACACAGGATCAGTGG - Intergenic
1053191691 9:36076504-36076526 TGCTCCCAACAGTGGATCAAAGG + Intronic
1055393183 9:75845438-75845460 GAGTCCCCACACAGGATGAAGGG + Intergenic
1058806424 9:108596606-108596628 TTACCCCAACACAGGTTGAATGG - Intergenic
1061005008 9:127923738-127923760 TTGTCCACCCACTGGATCAATGG + Intronic
1190176885 X:48157865-48157887 TTCTCCCTCCACAGGACCAAAGG + Intergenic
1190191048 X:48277637-48277659 TTCTCCCTCCACAGGACCAAAGG - Intergenic
1193315179 X:80056556-80056578 TTTTCCCAAAACAGGGTCAGTGG + Intergenic
1194187816 X:90794903-90794925 TTTTCCTAAAACAGGATCTATGG - Intergenic
1199450625 X:147974836-147974858 ATTTCCCAACAAAGGATGAATGG + Intergenic
1200534403 Y:4376852-4376874 TTTTCCTAAAACAGGATCTATGG - Intergenic