ID: 1012627818

View in Genome Browser
Species Human (GRCh38)
Location 6:101425845-101425867
Sequence AAAACTGATGCTCAGAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 477
Summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 436}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012627818_1012627821 -3 Left 1012627818 6:101425845-101425867 CCTGTCTTCTGAGCATCAGTTTT 0: 1
1: 0
2: 4
3: 36
4: 436
Right 1012627821 6:101425865-101425887 TTTCCTCTCCAGGATTTGAAGGG 0: 1
1: 0
2: 3
3: 21
4: 245
1012627818_1012627824 9 Left 1012627818 6:101425845-101425867 CCTGTCTTCTGAGCATCAGTTTT 0: 1
1: 0
2: 4
3: 36
4: 436
Right 1012627824 6:101425877-101425899 GATTTGAAGGGCATACTGATTGG No data
1012627818_1012627820 -4 Left 1012627818 6:101425845-101425867 CCTGTCTTCTGAGCATCAGTTTT 0: 1
1: 0
2: 4
3: 36
4: 436
Right 1012627820 6:101425864-101425886 TTTTCCTCTCCAGGATTTGAAGG 0: 1
1: 1
2: 3
3: 32
4: 267
1012627818_1012627825 30 Left 1012627818 6:101425845-101425867 CCTGTCTTCTGAGCATCAGTTTT 0: 1
1: 0
2: 4
3: 36
4: 436
Right 1012627825 6:101425898-101425920 GGCAAGTCTCACTAGCACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012627818 Original CRISPR AAAACTGATGCTCAGAAGAC AGG (reversed) Intronic
900739623 1:4322804-4322826 AGAACTGAAGCTCAGTAAACAGG + Intergenic
900744998 1:4355068-4355090 GAAACTGAGGCTCAGCACACTGG + Intergenic
900902714 1:5527729-5527751 AAAACTGAGGCTCAGAGAAGGGG - Intergenic
901812760 1:11777130-11777152 GAAACTGAGGCTCAGAGGGCTGG + Intronic
902102350 1:14001767-14001789 ATAAATGGTGCTCAGAAAACTGG + Intergenic
902133658 1:14285449-14285471 AAGACTGAGGCTCAGGAGCCTGG + Intergenic
902207309 1:14878502-14878524 GAAACTGAGGCCCAGAAGAGGGG - Intronic
902706960 1:18212251-18212273 GAAACTGAAGCTCAGAACAGTGG + Intronic
903165783 1:21519499-21519521 AAAACTGAAGCTCAGAGGCTGGG + Intronic
903188147 1:21640888-21640910 ATAACTGCTGCCCACAAGACAGG - Intronic
903464708 1:23543993-23544015 AAAAGTGATGCTAAGAAGTCGGG + Intergenic
903766322 1:25737048-25737070 AAAACTGAAGCCCAGAATTCTGG - Intronic
904465559 1:30705256-30705278 AAATCTGATGCCAAGAAGAGGGG + Intergenic
904539410 1:31222693-31222715 CAAACTGAAGCTCAGGAGAGGGG + Intronic
905419764 1:37833253-37833275 AAAACTGATGCTCAGACAGTAGG + Intronic
907050275 1:51325590-51325612 GAAACTGAGGCACAGAGGACGGG + Intronic
907099151 1:51812244-51812266 GAATCTGATGCTCAGTAGGCTGG + Intronic
907981881 1:59490744-59490766 ATAAATGGTGCTCAGAAAACTGG - Intronic
908735876 1:67276349-67276371 ATAAATGATGCTGGGAAGACTGG + Intergenic
910080508 1:83336309-83336331 AAAAATGAAGCAGAGAAGACAGG + Intergenic
910235221 1:85028695-85028717 GAAACTAAGGCTCAGAAGCCAGG - Intronic
911319235 1:96392491-96392513 ATAAATGATGCTGAGAAAACTGG + Intergenic
911886899 1:103313280-103313302 AAAACTGAGGCTCAGAAAGAGGG + Intergenic
912482537 1:109994726-109994748 AAAGCTGGTGCTCAGAAGCTGGG - Intronic
912691218 1:111805849-111805871 AAAACAGAGGCTCAGAGGTCTGG + Intronic
912691926 1:111811087-111811109 AAAACTGATGATCAGGGGAGAGG + Intronic
912886667 1:113482170-113482192 AATTGTGATACTCAGAAGACAGG + Intronic
913255113 1:116945725-116945747 AAAGCTGATTCACAGACGACAGG - Intronic
914335531 1:146711712-146711734 AAAACTGAGGCTCAGAGGACAGG - Intergenic
914713528 1:150235674-150235696 AAATCCGATCCTCAGAATACTGG + Intronic
916185276 1:162125499-162125521 ACAAATGATGCTGAGAAAACTGG - Intronic
916518860 1:165545168-165545190 AAAACTGAGGCTCAGAGAAATGG - Intronic
916986163 1:170193259-170193281 ATAAATGATGCTGAGAAAACTGG - Intergenic
917601704 1:176581186-176581208 ATAAATGGTGCTCAGAAAACTGG - Intronic
918813641 1:189153380-189153402 AAAAATGATGCTAGGAAAACTGG - Intergenic
919143992 1:193609794-193609816 CAAACTGTTGCTCTGAAAACAGG - Intergenic
919834384 1:201563618-201563640 AAAACTGAGGCTCAGAGAAGTGG - Intergenic
920985034 1:210880502-210880524 ACAAATGTTGCTCTGAAGACTGG + Intronic
922974181 1:229769891-229769913 AAAAAGGATGCACAGAAGTCAGG - Intergenic
923182275 1:231530934-231530956 AAAACTGTAGTTCAGCAGACGGG - Intronic
923216381 1:231851815-231851837 AAAACAGAGGTTCAGAAGAGTGG - Intronic
923437268 1:233979215-233979237 AAAACTGGTGCTGAGAGGCCAGG - Intronic
1063161004 10:3418822-3418844 CAAAATGATGCTCAAAAAACTGG + Intergenic
1063653263 10:7961673-7961695 AATACAGATGATCAGAAAACAGG - Intronic
1064336847 10:14451128-14451150 AAAAATGATGCTGGGAAAACTGG + Intronic
1064955699 10:20906372-20906394 ACTACTGATGCTCAGAAGTTTGG + Intronic
1065066397 10:21969843-21969865 TAAACTCATGGTCAGAAGATGGG - Intronic
1067250324 10:44581083-44581105 AAAAATGAAGCTGAGAAAACAGG + Intergenic
1068141880 10:53019358-53019380 AAGTCTGATGCTCATAGGACAGG - Intergenic
1068203977 10:53823298-53823320 ATAACTCAGTCTCAGAAGACAGG - Exonic
1068271409 10:54730675-54730697 ATAAATGATGCTGAGAAAACTGG + Intronic
1068836665 10:61562586-61562608 ACAACTGATGCTGGGAAGATTGG + Intergenic
1069272789 10:66551279-66551301 AAAAATGAAGGTCAGAAGACAGG - Intronic
1070484087 10:76913191-76913213 AAAAGTGCTGCTCAGCAGAGGGG - Intronic
1070777401 10:79117881-79117903 AAAGCTCATGCTCAGAAAAGAGG - Intronic
1071044271 10:81354772-81354794 AAAAATGGTGCTGAGAAAACTGG - Intergenic
1071112735 10:82179472-82179494 ACAAATGATGTTCAGAAAACTGG - Intronic
1071899561 10:90105629-90105651 ATAAGTGATGCTAAGAAAACTGG + Intergenic
1072482094 10:95818800-95818822 ATCACTGAAGCTCAGAAGACTGG - Intronic
1072485456 10:95850189-95850211 CAAACTGAGGTTCAGAAGGCTGG - Intronic
1072748920 10:97962542-97962564 GAAACAGATGCTCTGAAGACTGG + Intronic
1073765466 10:106677454-106677476 AAGACTGATTCTCTGAAGCCTGG - Intronic
1075872855 10:125783166-125783188 GAAACTGATGCTCCGACGACAGG - Intergenic
1075967835 10:126628161-126628183 AAAACTGAGCCACAGAACACAGG - Intronic
1076045723 10:127292879-127292901 CAAACTGGTGATCAGGAGACAGG - Intronic
1076058790 10:127396971-127396993 GTAACTGATGCTCAGATCACAGG - Intronic
1076058810 10:127397197-127397219 GTAACTGATGCTCAGATCACAGG - Intronic
1076787621 10:132758871-132758893 AAACCCGACGCTCAGGAGACAGG - Intronic
1076809392 10:132878807-132878829 CAAACTCATCCTCAGAAGAAAGG + Intronic
1077963129 11:7096615-7096637 AAAACTAATCCTCAGTAGATTGG - Intergenic
1078079163 11:8191686-8191708 AAAACTGAGGCTCAGAAATAGGG - Intergenic
1079161249 11:17996304-17996326 AAAACTGAGGCCCTGAAGAGAGG + Intronic
1079284815 11:19118844-19118866 AGAACAGAGGCTCAGAAAACTGG + Intronic
1079524454 11:21367743-21367765 AAAACTGAGGCACAGAGGAGTGG + Intronic
1080134132 11:28834311-28834333 AAAAAAGATTCTCAGAGGACTGG + Intergenic
1080180741 11:29422980-29423002 AAAACTAAAGCTTAAAAGACTGG - Intergenic
1080213129 11:29810134-29810156 GAAATTGATTCTCAGAAGAAGGG - Intergenic
1081167567 11:39824501-39824523 ATAAATGATGCTGAGAAAACTGG + Intergenic
1081675184 11:44964474-44964496 AAAAATGAAGCTCAGGAGAATGG - Intergenic
1083059262 11:59852466-59852488 AAACATGTTGCTCAGAAGAAAGG - Intergenic
1083657404 11:64236110-64236132 GAGACTGATGCACAGGAGACAGG + Intronic
1084005138 11:66318548-66318570 ACCACATATGCTCAGAAGACAGG - Intergenic
1085541913 11:77278924-77278946 AAGACTGATTTTCAGAAGATGGG + Intronic
1085598166 11:77829525-77829547 ACAAATGATGCTGAGAAAACTGG + Intronic
1085837945 11:79976360-79976382 GAAACTAAGGCTCAGAAAACAGG + Intergenic
1085919412 11:80934137-80934159 AAGACTGAAGCCCAAAAGACAGG + Intergenic
1085980884 11:81723639-81723661 ATAAATGATGCTGAGAAAACTGG + Intergenic
1086051204 11:82592780-82592802 ACAAGTGATCCTCAGAACACAGG + Intergenic
1086445971 11:86870693-86870715 AAAATTGATGCACAGATGAAAGG - Intronic
1087177973 11:95112409-95112431 AAAACTGAAACTCAGATGAATGG - Intronic
1087235905 11:95718347-95718369 AAAATTGAAGGTCAGCAGACGGG + Intergenic
1087954737 11:104271647-104271669 AATTCTGTTGCTCAGAAGGCTGG + Intergenic
1088021406 11:105124473-105124495 AAAATTGATGATGAGAAGCCAGG + Intergenic
1088413146 11:109558322-109558344 ATAAATGGTGCTGAGAAGACTGG - Intergenic
1089683805 11:120134264-120134286 AGAGCTGAGGCCCAGAAGACAGG + Intronic
1089747387 11:120626936-120626958 AACACTGATGGTCAGCACACCGG + Intronic
1089815572 11:121171152-121171174 AAAACTGGTGCTGAGAAAACTGG - Intronic
1090488767 11:127139427-127139449 AAAACCGATGCTCTGAGGATGGG - Intergenic
1090625676 11:128606436-128606458 ACAACTGAAGCTCAGAAAGCAGG + Intergenic
1090830094 11:130415293-130415315 AAAATTGCTTCTCAGAAGAGGGG - Intronic
1090966744 11:131604778-131604800 AAAACTGATGCTAGGACAACTGG - Intronic
1091012246 11:132013044-132013066 AGATCTGATGCTCAGAAGTGAGG + Intronic
1091229559 11:133979146-133979168 AAAACTAAAGCCCAGAAGAGAGG - Intergenic
1091262057 11:134242434-134242456 AAACCTGATGCTCAGCTCACAGG - Intronic
1091995081 12:4987108-4987130 ATAACTGAGGCTCAGAGCACAGG + Intergenic
1092313765 12:7388044-7388066 ACAAATGATGCTGGGAAGACTGG + Intronic
1093158719 12:15719308-15719330 TAAACTGCTACTCAGAAAACAGG - Intronic
1095828228 12:46553321-46553343 CAAACTGGGGCTCAGAAGACTGG - Intergenic
1096477734 12:51918660-51918682 GAAACTGATGCTCAGAGAAGGGG - Intronic
1097774796 12:63632981-63633003 ATAAATGATGCTCGGAAAACTGG + Intronic
1097999317 12:65923340-65923362 TAAAATGATGTTCTGAAGACTGG + Intronic
1099410482 12:82320668-82320690 AAATCTAATTCTCGGAAGACAGG + Intronic
1099502155 12:83427255-83427277 AAAAATGATGCTGGGAAAACTGG - Intergenic
1100156085 12:91802046-91802068 ATAGCTGAAGCTCAGGAGACAGG + Intergenic
1100540170 12:95549722-95549744 AAAACTGATGATGAAAAGATAGG - Intronic
1100793392 12:98154652-98154674 ATAACTCTTGCTGAGAAGACAGG + Intergenic
1100820438 12:98424482-98424504 AAAAGAGATTCTCAGAAAACAGG + Intergenic
1102657166 12:114491801-114491823 AAAACTGAGGCTCAGAAAGAAGG + Intergenic
1102818953 12:115891751-115891773 AAAACAGAAGCTCTGAAGCCAGG + Intergenic
1102856468 12:116298758-116298780 AAAACTGAGGCTCAGAAAGGGGG - Intergenic
1103159779 12:118719457-118719479 AAAACTGAGACTCAGGAGACAGG + Intergenic
1103263027 12:119605311-119605333 AAAACTGAGGCTCAGAAATGTGG + Intronic
1103317602 12:120069030-120069052 AAAACTGAAGCTTAGAAAAGGGG - Intronic
1104137289 12:125952633-125952655 CCACCTGATGCTCTGAAGACTGG - Intergenic
1104296126 12:127515331-127515353 AAGCCTGATTCACAGAAGACTGG - Intergenic
1105486858 13:20841863-20841885 AAGACTGATGATAAGCAGACAGG - Intronic
1106479388 13:30125192-30125214 AATATTGATGCTCAGAAAAGTGG - Intergenic
1106963663 13:35033229-35033251 ATAAATGATGCTGAGAAAACTGG - Intronic
1107253418 13:38392988-38393010 AAAGATGATGGACAGAAGACAGG - Intergenic
1107668648 13:42719267-42719289 ATAGCTGAGGCTCAGAAGCCAGG + Intergenic
1107723216 13:43271220-43271242 ATAACTGATGTCCAGAAGAAGGG + Intronic
1109882416 13:68497127-68497149 ACAAATGATGCTTAGAAAACTGG + Intergenic
1109915432 13:68979191-68979213 AAAAATGATGTTGGGAAGACTGG - Intergenic
1110427163 13:75381361-75381383 AAAACTGATGGTGAAAAGCCAGG - Intronic
1110550942 13:76810984-76811006 AAAACTCTTGCTAAGAAGAAAGG + Intergenic
1111077666 13:83259568-83259590 ATAAATGATGCTGAGAAAACTGG + Intergenic
1111638661 13:90938409-90938431 AAAACTTATTCTCAGGATACTGG - Intergenic
1112081309 13:95974502-95974524 AACAATAATGCTCAGAAAACAGG + Intronic
1112659174 13:101487879-101487901 TCAAATGATGCTCCGAAGACAGG + Intronic
1115655078 14:35435654-35435676 AAGACTCATGATCAGAAGATTGG - Intergenic
1115986541 14:39108333-39108355 AAAACTCATGCTCTGACCACTGG + Intronic
1116628486 14:47298130-47298152 AAAACTGAGGCACAGAAAGCTGG + Intronic
1116906185 14:50406054-50406076 ACAACTGGTGTTAAGAAGACTGG - Intronic
1117116480 14:52518404-52518426 GCAACTGAGGTTCAGAAGACTGG - Intronic
1117125175 14:52615178-52615200 ATAAATGGTGCTCAGAAAACTGG - Intronic
1117651335 14:57909008-57909030 ATAAATGGTGCTCAGAAAACTGG - Intronic
1117815925 14:59597756-59597778 GAAACTGATCCTCAGAGGACAGG + Intronic
1118021822 14:61724699-61724721 AAAACTGATGGAAATAAGACAGG - Intronic
1118373044 14:65153876-65153898 AAAACTTATGCCCAGAATCCTGG - Intergenic
1119235497 14:73015737-73015759 AATAGTGTTGCTCAGAATACTGG - Intronic
1119627769 14:76196216-76196238 AAAACAAAAGCTCAGATGACTGG - Intronic
1120343150 14:83247009-83247031 AAAACTGCTGGTCAGGAGATGGG - Intergenic
1121279456 14:92688492-92688514 GAAACTGAGGCTCAGGAGAGAGG + Exonic
1122168989 14:99855192-99855214 AAAATTTATGCAAAGAAGACTGG + Intronic
1122969610 14:105147186-105147208 GAAACTGAGGCTCAGAAGAGAGG + Intronic
1125421351 15:39507883-39507905 AAAAATGGTGCTGAGAAGAAAGG - Intergenic
1125829177 15:42700982-42701004 ATAAATGATGCTGAGAAAACTGG - Intronic
1126349274 15:47727775-47727797 AAAACTGTTGCTATGAATACTGG - Intronic
1126355280 15:47789026-47789048 AAAACTGCTTCTTAGAAGACTGG + Intergenic
1127080468 15:55373359-55373381 AAAACAGTTCTTCAGAAGACAGG + Intronic
1127133111 15:55888866-55888888 ATAACTGGTGCTGAGAAAACTGG + Intronic
1127285088 15:57525459-57525481 GAAACATATGCTCAGAAAACTGG - Intronic
1127329552 15:57925148-57925170 AAAACAGAAGCTCAGGAGGCAGG - Intergenic
1127571651 15:60249638-60249660 AAAACTGGTGATGAGAAAACAGG + Intergenic
1127991157 15:64118833-64118855 ATAACTGATCCTGAGAAGATAGG + Exonic
1128333025 15:66768677-66768699 ACTACTGATGCTCAGAGGTCAGG - Intronic
1129821384 15:78604334-78604356 AAAACTGACGGTCAAAGGACAGG + Intronic
1130399991 15:83542193-83542215 ATAAATGATGCTGAGAAAACTGG - Intronic
1131622373 15:94081505-94081527 AAAACTGAGGCCCAGAGGAGGGG - Intergenic
1133444761 16:5850676-5850698 GAAACTGAGGCTCAGAGAACTGG + Intergenic
1133528189 16:6626989-6627011 GAAACTGAGGCACAGAAGGCTGG + Intronic
1133617894 16:7496107-7496129 GAAACTGATGCCCAGAAGGTAGG - Intronic
1134064709 16:11220552-11220574 GAAACTGAAGCACAGAAGAAGGG - Intergenic
1135046192 16:19157902-19157924 GAAACCGAGGCTCAGAAAACTGG + Intronic
1135567698 16:23524563-23524585 AGCACTGATCCTCAGAACACAGG - Intronic
1135902225 16:26472298-26472320 ATAAATGATGCTGAGAAAACTGG + Intergenic
1135931778 16:26744104-26744126 TAAACTCAATCTCAGAAGACAGG + Intergenic
1137629398 16:49931608-49931630 AAAACTGAGGCCCAGAGGAGAGG + Intergenic
1138221453 16:55255247-55255269 AAACATGATGCTGAGAGGACTGG - Intergenic
1139696011 16:68675475-68675497 AAAACTGAGGTTCAGAAGCCAGG - Intronic
1139998094 16:70999516-70999538 AAAACTGAGGCTCAGAGGACAGG + Intronic
1140111182 16:72006554-72006576 AACACTCATCTTCAGAAGACTGG - Intergenic
1140178222 16:72686818-72686840 AAAAATGATGCTGGGAAAACTGG - Intergenic
1140256386 16:73340120-73340142 AAGACTGATGCTCAGAAACAAGG + Intergenic
1140339871 16:74146901-74146923 AAACCAGTTGCTCAGAAGTCTGG + Intergenic
1144443799 17:15308217-15308239 CAAACTGCTGCTTATAAGACAGG + Intronic
1144603187 17:16637633-16637655 AAAAATGGTGCTCGGAAAACTGG + Intronic
1145194144 17:20872370-20872392 AAAGCTGATGCTCAGAGAAGGGG - Intronic
1145297894 17:21608790-21608812 AAAGCTGATGCTCAGAGAAAGGG + Intergenic
1145352364 17:22094609-22094631 AAAGCTGATGCTCAGAGAAAGGG - Intergenic
1148219646 17:45852429-45852451 AAAATTGAAGCTCAGAGGGCTGG - Intergenic
1148970137 17:51472790-51472812 AAAACTGATGCTCAGAGTCCTGG - Intergenic
1149432974 17:56609264-56609286 AAAAGTGTTGCTCAGAGGGCCGG + Intergenic
1149668608 17:58384645-58384667 GAAACCGATGCCCAGAAGCCAGG - Intronic
1151852977 17:76701852-76701874 CAAACTCTTGCTCAGATGACTGG + Intronic
1152626161 17:81388794-81388816 GTAACTGATGCTCAGAGGACCGG + Intergenic
1153937357 18:9940640-9940662 AATACTGATCCTGAGAAGAATGG + Intronic
1156525955 18:37767539-37767561 AAAATTGATACTCAGAAGTGAGG - Intergenic
1157109498 18:44807166-44807188 CAGACTGAGGCTCAGAACACAGG + Intronic
1158108217 18:53909206-53909228 ACAACTGAATCTCAGTAGACTGG - Intergenic
1158657496 18:59352350-59352372 AAAACTGGTACTAAGAATACTGG + Intronic
1158708233 18:59813677-59813699 GCAACTGAAGCTCAGAAGAAGGG + Intergenic
1159206423 18:65259008-65259030 ATAAATGGTGCTCAGAAAACTGG + Intergenic
1159415960 18:68149881-68149903 ATAAATGATGCTGGGAAGACTGG + Intergenic
1160238957 18:77108953-77108975 GAAACTGAGGCTCAGAAAAGTGG - Intronic
1160698286 19:494898-494920 AAAACTGAGGCCCAGAGGAGGGG - Intronic
1160878715 19:1309955-1309977 CAAACTGAGGCTCAGAGAACAGG - Intergenic
1163581379 19:18141235-18141257 AAAACTGAGGCTCAGGGGCCAGG - Intronic
1165094761 19:33404015-33404037 GAAACTGAGGCTCAGATCACGGG + Intronic
1165122007 19:33566201-33566223 AAAAGAGATGCTGAGAAGGCAGG - Intergenic
1166273340 19:41732712-41732734 AAAAGTGAGACACAGAAGACAGG - Intronic
1166979076 19:46622132-46622154 GAAACTGAAGCTCAGAAGAAAGG + Intronic
1168627257 19:57929186-57929208 AAATCTGATGCTCTCAAGAATGG + Intronic
926096717 2:10086025-10086047 AAAACTGAGGCTCCGAAGAGTGG + Exonic
926371170 2:12180311-12180333 AAAACTGATATTAGGAAGACTGG + Intergenic
927073788 2:19556277-19556299 AAAACTGATTCACAGAGGAGAGG + Intergenic
927448693 2:23187963-23187985 CAAAAAGATGCTCAGAGGACAGG + Intergenic
928178884 2:29053677-29053699 AAAACATTTGCTCAGATGACAGG - Exonic
929004042 2:37378470-37378492 GGAACTGTTGCTCAGAGGACAGG - Intergenic
929403273 2:41610725-41610747 AAAACTGAAACTCAGGAGACAGG + Intergenic
929630675 2:43458414-43458436 GAAACTGAGGCTCAGAAGTTAGG - Intronic
932085946 2:68761154-68761176 AAAAATGATGCTAGGAAAACTGG + Intronic
932875171 2:75443788-75443810 AAAAGTGACGCTCACAAAACTGG - Intergenic
933229036 2:79784576-79784598 ACAACTGATACACAGAAAACTGG - Intronic
933418095 2:82013134-82013156 TAGGCTGATGCTCAGAAGAGAGG - Intergenic
933451038 2:82452319-82452341 ATAAATGATGCTGAGAAAACTGG + Intergenic
934558396 2:95299546-95299568 GACACTGAGGCTCAGAAAACTGG + Intronic
934900042 2:98152438-98152460 AAAGCAGCTGCTCAGAAGATTGG - Intronic
935475030 2:103508985-103509007 AAAACGGATGCCCAGAAAGCTGG + Intergenic
936889962 2:117358021-117358043 AAAAATGATGCTGAGAAAACTGG - Intergenic
936900571 2:117477506-117477528 ATAAATGGTGCTCAGAAAACTGG + Intergenic
936931692 2:117796488-117796510 ATAAATGGTGCTCAGAAAACTGG + Intergenic
936995954 2:118414476-118414498 ATAAATGGTGCTCAGAAAACTGG + Intergenic
939592977 2:144088737-144088759 ATAAATGATGCTGAGAAAACTGG + Intronic
939698519 2:145359023-145359045 GAAACTGAGGCACAGTAGACGGG - Intergenic
942718411 2:178921364-178921386 AAAACTGATGCTCAGAAAAGTGG - Intronic
942975009 2:182005851-182005873 TAAACTGAAGCTCATAAGATTGG - Intronic
944296790 2:198074230-198074252 AAAATTTATGCTCTGAAGAAAGG + Intronic
944335613 2:198530302-198530324 ATAAATGATGCTGAGAAAACTGG + Intronic
946146401 2:217734456-217734478 AGAACAGATGCTCAGAAGAAGGG - Intronic
946296116 2:218784908-218784930 AAAACTGGTGCCAAAAAGACTGG - Intronic
947825285 2:233101911-233101933 TAAACTGAAGCTCAGAAGAATGG - Intronic
948161548 2:235828935-235828957 AAAACTGAGGCTCAGAACTCTGG - Intronic
948411592 2:237766782-237766804 ATAACTGATGCTCAGAATGAAGG - Intronic
1168971703 20:1935677-1935699 AAAAATGATGGTGAGAAGAATGG + Intronic
1170402013 20:15996926-15996948 ATAACTGATGCTGGGAAAACTGG - Intronic
1171562692 20:26139883-26139905 AAAGCTGATGCTCAGAGAAGAGG - Intergenic
1171569241 20:26232382-26232404 AAAAATGATTCTGAGAAGAGGGG + Intergenic
1171819742 20:29823843-29823865 AAAACTGAAGCTCCCAATACTGG + Intergenic
1172176230 20:32973479-32973501 AAAACTGAGGCTTAGAAAAAAGG - Intergenic
1173124624 20:40325276-40325298 AAAACCAGAGCTCAGAAGACTGG + Intergenic
1173622707 20:44448890-44448912 AAAACTGAAGCTCAGAAAGGAGG - Intergenic
1174204099 20:48827159-48827181 AAACCTGAAGCTCAGAGGAGGGG - Intronic
1174418205 20:50381775-50381797 TAAAATGTTGCACAGAAGACAGG - Intergenic
1175623527 20:60470967-60470989 AAAAATGAAGACCAGAAGACAGG + Intergenic
1177473586 21:21590428-21590450 AAAAATGATGCTATGATGACTGG + Intergenic
1177538041 21:22454978-22455000 AAAACTGATTCACAAAAGTCTGG + Intergenic
1178754867 21:35339038-35339060 AAAACTGGTGCTTAGAACAATGG + Intronic
1178928900 21:36799851-36799873 AGAACTGAGGCTTAGAAAACTGG - Intronic
1179523560 21:41960886-41960908 AAAACTGTAGCCCAGAAGACAGG - Intergenic
1180323743 22:11348534-11348556 AAAACTGAAGCTCCCAATACTGG + Intergenic
1181027409 22:20133987-20134009 GAAACTGGTGCTCAGCAGAGTGG - Intronic
1181329920 22:22082115-22082137 ATAAATGATGCTGAGAAAACTGG + Intergenic
1181946564 22:26522204-26522226 AAAACTGAGGCTCAGAGAAGGGG + Intergenic
1182012841 22:27015001-27015023 AAAACTGAGGCTCAGAGTAGTGG + Intergenic
1182023234 22:27098448-27098470 CAACCTGATACTCAGAACACAGG + Intergenic
1182729688 22:32477581-32477603 ATAACTGATGATCAGTAGAAGGG + Intronic
1183428825 22:37753615-37753637 AAGACTGAAGCTCAGAAAAGTGG + Intronic
1184268642 22:43364673-43364695 GAAACTGAGGCACAGAAGAAGGG + Intergenic
1185394336 22:50579053-50579075 GAAACTGAGGTTCAGGAGACCGG - Exonic
950155402 3:10718043-10718065 GAAACTGAGGCTCAGAAGTGAGG - Intergenic
951333483 3:21393304-21393326 ACAACTTCTGCTGAGAAGACAGG - Intergenic
953225171 3:41011953-41011975 CATATTGATGCTCAGAAGCCAGG - Intergenic
954478010 3:50767343-50767365 ATAAATGGTGCTCAGAAAACTGG - Intronic
954519391 3:51210597-51210619 AAAACTCATGCTCAGAAGCTTGG - Intronic
955114526 3:55984245-55984267 AACTCTGACTCTCAGAAGACAGG - Intronic
955388581 3:58500694-58500716 AAGACTTATGCTAAGAATACAGG - Intronic
957151296 3:76489113-76489135 AAATCTGATGATTAGAACACTGG + Intronic
957166696 3:76682900-76682922 AGAACTGGCGCTCAGAAGAAAGG + Intronic
957602989 3:82362094-82362116 AAAACTTACTCTCAGAAGATAGG + Intergenic
958597760 3:96251597-96251619 ATAACTGGTGCTGAGAAAACTGG - Intergenic
959224767 3:103565594-103565616 AAAACTGAAGATCAGGAGAAAGG + Intergenic
959720016 3:109475893-109475915 AAAAATGATGTTCAGACAACTGG - Intergenic
959994995 3:112670814-112670836 ACAACTTATACTCAGAAGGCTGG - Intergenic
960633811 3:119762736-119762758 ATAAATGATGCTGAGAAAACTGG + Intronic
960812508 3:121637945-121637967 AAAAGTGAAGCTCAGCAGAAAGG + Intronic
961375014 3:126458893-126458915 AAAACTGATTAACAGAAAACCGG + Intronic
961401488 3:126648611-126648633 ACAAATGATGCTGAGAAAACTGG + Intronic
961535367 3:127567358-127567380 GAAACTGAGGCACAGAATACAGG + Intergenic
962029490 3:131584296-131584318 AAAACTGGTACTCAGAGGAGAGG - Intronic
962640504 3:137380679-137380701 ATAAATGATGCTGAGAAAACTGG + Intergenic
962758618 3:138487588-138487610 ATAAATGGTGCTCAGAAAACTGG - Intergenic
962793491 3:138831935-138831957 AAAACAGAGGCCCATAAGACTGG + Intronic
962973649 3:140427519-140427541 ACATCTGATGCTTAGGAGACAGG + Intronic
963362790 3:144297479-144297501 TTAACTGATGCTGAGATGACTGG - Intergenic
963401497 3:144804628-144804650 ATAAATGATGCTGAGAAAACTGG - Intergenic
964350490 3:155798536-155798558 ATAACTGATGCTGGGAATACTGG + Intronic
965353874 3:167649592-167649614 CAAACTGAATCTCAAAAGACTGG - Intronic
966675148 3:182577662-182577684 AAAAGTGGTGCTAAGAAAACTGG + Intergenic
967141063 3:186560891-186560913 ATAAATGATGCTGAGAAAACTGG + Intronic
967280499 3:187817900-187817922 ACAACAGATGCTCTCAAGACTGG - Intergenic
967309951 3:188096308-188096330 AAAACTGAGGCCCAGAACAAGGG - Intergenic
967380136 3:188848631-188848653 AAAACTGAGGCACAGAGGAGGGG + Intronic
967513821 3:190342731-190342753 ATAAATGGTGCTCAGAAAACTGG + Intronic
969478064 4:7432457-7432479 AAAACTGAGGCTCAGACAGCTGG + Exonic
970137849 4:12945730-12945752 AAAACAAATGCTCAGAAGGAAGG + Intergenic
971477560 4:27086611-27086633 AAAACTGAGGCTTAGAGGAGTGG - Intergenic
971749658 4:30631112-30631134 ATAAATGATGCTGAGAAAACTGG + Intergenic
971764401 4:30811096-30811118 AAAACTGAGGCTCAGACAACTGG + Intronic
971896171 4:32597973-32597995 AGAACTGAGATTCAGAAGACTGG + Intergenic
971999075 4:34006495-34006517 AAAGCTGATGCTCAGAGAAGGGG + Intergenic
972256235 4:37358620-37358642 AAAACTGAGGCTTAGAATAGTGG - Intronic
972906135 4:43749771-43749793 ATCATTGATGCTCAGAAAACAGG + Intergenic
973237776 4:47924385-47924407 ATAAATGATGCTGAGAAAACTGG + Intronic
975065365 4:70056304-70056326 ATAAATGATGCTGAGAAAACTGG + Intronic
975392723 4:73837674-73837696 AAAACTGCTCCGCTGAAGACTGG - Exonic
975613397 4:76222895-76222917 CAAGCTGAAGCTCAGAAGAAAGG + Intronic
976136415 4:81942013-81942035 AAAACTGATGCTGGGAAAACTGG + Intronic
976452871 4:85211841-85211863 AAAAATTATGCTGAGAAAACTGG - Intergenic
976776559 4:88712914-88712936 ATAACTGGTGCTGAGAAAACTGG - Intergenic
976912905 4:90329794-90329816 AAAGCATCTGCTCAGAAGACAGG + Intronic
976979450 4:91208451-91208473 ATAAGTGGTGCTCAGAAAACTGG - Intronic
977307851 4:95347674-95347696 ATAAATGATGCTGAGAAAACTGG + Intronic
977499612 4:97822497-97822519 AAAACTGATACTAAGAAGTTGGG - Intronic
979594525 4:122519588-122519610 ATAAATGATGCTAGGAAGACTGG - Intergenic
980935625 4:139222847-139222869 AACACTGTTGGTCAGAAGAATGG - Intergenic
980955156 4:139420461-139420483 GGAACTGAGGCTCAGAAAACTGG + Intergenic
981622528 4:146718928-146718950 ATAAATGATGCTGAGAAAACTGG - Intronic
983079060 4:163363253-163363275 AAAATTGATGTTGAGAAGAGAGG - Intergenic
983612314 4:169661834-169661856 AAAACTGATAATCAGAACATAGG - Intronic
983885320 4:172974906-172974928 CACAGTGATGCTCAGAAGCCTGG + Intronic
984151636 4:176140706-176140728 AAAAGTGAGGATGAGAAGACTGG - Intronic
985012938 4:185602348-185602370 AAAGCAGATGCTCAGAAGACTGG + Intronic
985205889 4:187536510-187536532 AAAACTGAGGCTGTGAAGTCTGG - Intergenic
986480742 5:8184553-8184575 AAAATCGCTGCTCAGAAGTCAGG + Intergenic
986558479 5:9036615-9036637 ACAACATATGCTCAGAAGAGAGG - Exonic
987001294 5:13662932-13662954 GAAACTGATGCTTAGAAGTTAGG + Intergenic
987473901 5:18367034-18367056 AAAACTGATGGACATAAAACAGG + Intergenic
988638780 5:33017918-33017940 AAAACTGATGTTCAGAAAGAAGG - Intergenic
988857788 5:35246246-35246268 AACTCTGATGCACAGAACACGGG - Intergenic
988922536 5:35957050-35957072 AAAGGTAATGCTCAGAGGACAGG - Intronic
990840334 5:60072731-60072753 ATAAATGATGCTGAGAAAACTGG - Intronic
991287939 5:65000550-65000572 ATAAATGATGCTGAGAAAACTGG - Intronic
994148018 5:96416268-96416290 AAAACTTATGTTCAGATGAAGGG + Intronic
994376844 5:99024731-99024753 AAAACTGAGGTTCAGAAGTTGGG - Intergenic
994893175 5:105665832-105665854 AAAAATGATGCTGGGAAAACTGG - Intergenic
995615392 5:113957244-113957266 AAAAATGATGCTGGGAAAACTGG - Intergenic
995755632 5:115500881-115500903 ATAAATGATGCTCAGAAAATTGG - Intergenic
995851033 5:116545838-116545860 AAAAGAGGTGCTCCGAAGACAGG + Intronic
996155975 5:120101158-120101180 ATAAATGATGCTGAGAAAACTGG - Intergenic
996489393 5:124075274-124075296 ATAAATGATGCTCAGAAAATTGG - Intergenic
996742271 5:126811465-126811487 AACACTGATAATAAGAAGACTGG - Intronic
997182915 5:131850592-131850614 ACAAATGATGCTGAGAAAACTGG + Intronic
998258062 5:140604810-140604832 AAAAATAATGCTGAGAAAACTGG - Intergenic
998323330 5:141254077-141254099 AAAACTGATGCCCAGTAGGAAGG + Intergenic
998845739 5:146307875-146307897 AAAACTGAGGCTCAGAAGTTTGG - Intronic
999599152 5:153241495-153241517 AAAACTGAAGCTCTGAAGATGGG + Intergenic
1000271768 5:159691844-159691866 ATAAATGGTGCTCAGAAAACTGG + Intergenic
1000631181 5:163592531-163592553 ATAAATGGTGCTCAGAAAACTGG - Intergenic
1001370099 5:171191391-171191413 AAAACTGAGGTTCAGAGGCCGGG + Intronic
1001942571 5:175751089-175751111 AAAACTGATGCTCAGAGACATGG + Intergenic
1002431257 5:179205461-179205483 AAAACTAAGGCTCAGAGGACGGG + Intronic
1006657647 6:35609764-35609786 AAAACTGAAACTCAGAGGAAGGG - Intronic
1008207816 6:48684883-48684905 AAAACTGGTGTTGAGAAAACTGG + Intergenic
1008243841 6:49146341-49146363 ATAAATGATGCTGAGAAAACTGG - Intergenic
1009064779 6:58445875-58445897 ATAAATGGTGCTCAGAAAACTGG + Intergenic
1009226827 6:61027646-61027668 ATAAGTGATGCTGAGAAAACTGG + Intergenic
1009239666 6:61168934-61168956 AAAACTAATGATGAGAAGGCAGG - Intergenic
1009255507 6:61389094-61389116 AAAACTGCTGTACAGAAGAAAGG - Intergenic
1010651332 6:78458559-78458581 AAAACTGGTGTTCACAAGAGAGG + Intergenic
1010945324 6:81967347-81967369 AAAACTGGAACTCAGAAGAGAGG + Intergenic
1012520572 6:100116354-100116376 AAAAATCCTGCTCAGAAAACAGG - Intergenic
1012627818 6:101425845-101425867 AAAACTGATGCTCAGAAGACAGG - Intronic
1013083564 6:106834711-106834733 AAAAATGATGCTAGGAAAACTGG - Intergenic
1013587411 6:111591693-111591715 AAAACTGATGCTCTGCAGGGAGG + Exonic
1013644244 6:112120312-112120334 AAAACTGAAGATTAGAAGCCAGG - Exonic
1013956517 6:115848301-115848323 ATAAATGATGCTGAGAAAACTGG + Intergenic
1014856245 6:126405223-126405245 AAAAATGATGCTGGGAAAACTGG - Intergenic
1015376497 6:132515980-132516002 AAAGGGCATGCTCAGAAGACAGG - Intergenic
1015397607 6:132752722-132752744 TAAACTGAGGCTCAGAGTACAGG + Exonic
1016782282 6:147972614-147972636 AAGACTCATGCTCACCAGACTGG - Intergenic
1017246327 6:152230269-152230291 AAATCTGATGCTCAGTATACAGG + Intronic
1017821345 6:158051048-158051070 GAAACTGTTGCACAGATGACTGG - Intronic
1019150659 6:170003435-170003457 AAAAGTCATGATCAGTAGACAGG - Intergenic
1020353019 7:7244010-7244032 AACACAGATGGTCAGAAAACAGG - Exonic
1020899928 7:13991298-13991320 GAAACTGTTGCTCAGATTACAGG - Intronic
1024603643 7:51008151-51008173 GAAACTGAAGCTCAGAAAAGAGG - Intergenic
1024712649 7:52034555-52034577 AAAACTGATCTTAAGAAAACAGG + Intergenic
1025275113 7:57575516-57575538 AAAGCTGATGCTCAGAGAAGGGG + Intergenic
1025312021 7:57959119-57959141 AAAACTGGTCCTCAAAAGAAAGG + Intergenic
1026892630 7:73991387-73991409 GAAACTGAGCCTCAGAAGATGGG + Intergenic
1027298283 7:76801577-76801599 AAAAATGAAGCAGAGAAGACAGG + Intergenic
1028394926 7:90358535-90358557 AAAAATGATGCTGAGAAAATTGG + Intronic
1028851216 7:95540016-95540038 AAAACTGATGCTGAGGACAAAGG + Exonic
1029088666 7:98031511-98031533 GAAACTGAGGCTGAGAAGGCAGG - Intergenic
1030089549 7:105845817-105845839 AAAAATGATGCTGAGACAACTGG + Intronic
1030837639 7:114309265-114309287 GAAACTGAAGCTCAGGAAACTGG + Intronic
1032114772 7:129107610-129107632 AAAAATGATGCTGAGACAACTGG - Intergenic
1033383254 7:140845164-140845186 ACAAATGATGCTGAGAAAACTGG + Intronic
1035097263 7:156365676-156365698 AAACGTGATGGTCAGAAGCCGGG - Intergenic
1036413971 8:8529582-8529604 AAACCTAATTCTCAGAAAACTGG - Intergenic
1036417336 8:8563004-8563026 ATTACTGCTGCTCAGAACACAGG + Intergenic
1037178107 8:15971052-15971074 AAATCTTGTGCTCAGAAGAGTGG + Intergenic
1037427829 8:18776070-18776092 ATAAATGGTGCTCAGAAAACTGG - Intronic
1039640461 8:39214913-39214935 ATAAATGATGCTGAGAAAACTGG - Intronic
1040423675 8:47263094-47263116 GAAACTGAGGCTCAGCAGAGAGG + Intronic
1040470036 8:47729288-47729310 GAGACTGAAGCTCTGAAGACAGG + Intronic
1040659830 8:49558197-49558219 AAAAATGATGCTGGGAAAACTGG + Intergenic
1041172679 8:55161051-55161073 AAAGCCGAAGCTCAGAACACAGG - Intronic
1041798462 8:61772215-61772237 AAAACTGATCAACAGAAGAAGGG + Intergenic
1042710643 8:71713283-71713305 AATACTTAGGCACAGAAGACAGG + Intergenic
1043312050 8:78872794-78872816 ATAAATGATGCTGAGAAAACTGG - Intergenic
1043570379 8:81596023-81596045 AAAACAGGTGCTCAGAAGCTTGG + Intergenic
1044540544 8:93404277-93404299 AAAACTGAATCTGAGAAGCCAGG + Intergenic
1045793402 8:106013413-106013435 AAAACGTATGCTCAGAATATAGG + Intergenic
1047369748 8:124246473-124246495 TAAAAAGATGCTCACAAGACAGG + Intergenic
1047742484 8:127818001-127818023 AGAACTGATGCCCAGGAGAGGGG + Intergenic
1048007010 8:130427584-130427606 GAAACTGAGGCTCAGAAAAAAGG + Intronic
1048013457 8:130477225-130477247 AATAGTGAGGCTGAGAAGACAGG + Intergenic
1050033300 9:1408867-1408889 ACAAATGGTGCTCAGAAAACTGG - Intergenic
1050361001 9:4831044-4831066 GAAACTGAGGCCCAGGAGACAGG + Intronic
1050874714 9:10619482-10619504 AAAACTCATTTTCAGAAAACAGG + Intergenic
1051242270 9:15071461-15071483 AAAACTGATGATGAGAACACAGG + Intergenic
1052060554 9:23955466-23955488 AGACCTGATGCTCAGAAAATAGG + Intergenic
1052509118 9:29391426-29391448 ATAAATGATGTTCAGAAAACTGG - Intergenic
1052529657 9:29665432-29665454 ATAAATGGTGCTCAGAAAACTGG + Intergenic
1052555328 9:30006962-30006984 AAAACTGATGTTATGGAGACAGG + Intergenic
1055133521 9:72803149-72803171 ATAAATGATGCTAAGAAAACTGG + Intronic
1056742708 9:89273666-89273688 AAAATTTTTGCTCAGAAGTCTGG + Intergenic
1057291484 9:93810040-93810062 AACACAGATGCTCAGAGGTCTGG - Intergenic
1057494238 9:95547281-95547303 AAAACTCATTCAAAGAAGACAGG + Intergenic
1057929307 9:99179681-99179703 AAAACTGAGTCCCAGAAGAAGGG + Intergenic
1058204171 9:102082192-102082214 AAAACTGACTATCAGAAGAACGG - Intergenic
1058408090 9:104699768-104699790 AAAACTGAGGCTAAGAATAATGG + Intergenic
1058981342 9:110173546-110173568 AAAACTGATGGTCAGGGGTCAGG - Intergenic
1059267038 9:113044166-113044188 AAAACTCAAGCTAAGAAGAATGG - Exonic
1060757536 9:126224085-126224107 ATGACTGATGCTCAGAAGTGTGG - Intergenic
1060869071 9:127024836-127024858 AAAACAGCTGCGCAAAAGACTGG - Intronic
1061105907 9:128530197-128530219 GAATCTGAAGCTCAGAAGAAAGG - Intronic
1061908353 9:133710252-133710274 GAAACTGAGGCTCAGAGAACAGG + Intronic
1062053462 9:134458831-134458853 AAAACTCAGGCTCAGAGGACAGG - Intergenic
1203371414 Un_KI270442v1:309108-309130 AAAACTGAAGCTCCCAATACTGG + Intergenic
1203626379 Un_KI270750v1:29338-29360 AAAGCTGATGCTCAGAGAAGGGG + Intergenic
1185830234 X:3294618-3294640 AAAAATGATTTTCAGATGACTGG - Intergenic
1186140409 X:6566200-6566222 ATAACTGGTGCTGAGAAAACTGG - Intergenic
1186331199 X:8536031-8536053 AAAAATGATCCCCAAAAGACTGG - Intronic
1187210245 X:17223159-17223181 AAAACTCATGGTCAGAAGATGGG + Intergenic
1187645870 X:21346528-21346550 AAAACCAATGCTCTGAAAACTGG - Intergenic
1188092601 X:25981652-25981674 ATAACTGATGCTGGGAAAACTGG + Intergenic
1188172654 X:26947094-26947116 TAAAATGGTGCTCAGACGACTGG - Intergenic
1188420746 X:29987973-29987995 AGAAATGGTGCTCAGAAAACTGG - Intergenic
1188640647 X:32498916-32498938 AAGACATATGCTGAGAAGACAGG - Intronic
1189130577 X:38494026-38494048 ATAACTGATGCTCAGAGTAATGG + Intronic
1189225071 X:39406206-39406228 ATAAGTGATGCTGTGAAGACTGG - Intergenic
1189624239 X:42878547-42878569 AAAAGTGTTCCTCAGAAGACAGG + Intergenic
1191221501 X:57992422-57992444 ACAAATGATGCTGAGAAAACTGG - Intergenic
1191274350 X:58522058-58522080 AAAACTGCTCCTCAAAAGAAAGG - Intergenic
1191566202 X:62535644-62535666 AAAACTGCTCCTCAAAAGAAAGG - Intergenic
1192009836 X:67257053-67257075 AAAAATGATGCTGGGAAAACTGG + Intergenic
1192158909 X:68768369-68768391 GAAACTGAGGCTCAGAAGAGAGG - Intergenic
1193142563 X:78043500-78043522 AAAACTAATAGTAAGAAGACAGG - Intronic
1194194338 X:90872913-90872935 ATAAATGATGCTAAGAAAACTGG + Intergenic
1194390327 X:93310184-93310206 ATAATTGGTGCTCAGAAAACTGG + Intergenic
1194405089 X:93487019-93487041 AAAACTGAAGTTCAGAAAACAGG - Intergenic
1194747409 X:97643296-97643318 AAAAATGATGCTGGGAAAACTGG + Intergenic
1194857592 X:98953078-98953100 ATAAATGATGCTGGGAAGACTGG - Intergenic
1195198927 X:102527667-102527689 AAAACTAATACTCAGAAGAGTGG - Intergenic
1195843811 X:109204560-109204582 ACAAATGATGCTGAGAAAACTGG - Intergenic
1196066873 X:111473505-111473527 AAAGCTAATGTTCAGAAGAAAGG + Intergenic
1196541983 X:116921308-116921330 ATAAATGGTGCTCAGAAAACAGG + Intergenic
1198101717 X:133427861-133427883 AAAGCTGATGGTCAGAGTACAGG - Intergenic
1198927698 X:141817293-141817315 AAGAGTAATGCTCTGAAGACAGG + Intergenic
1199333869 X:146595405-146595427 ATAAATGGTGCTGAGAAGACTGG - Intergenic
1200102791 X:153696384-153696406 AAAGCTGCTACACAGAAGACTGG - Exonic
1200540951 Y:4455303-4455325 ATAAATGATGCTAAGAAAACTGG + Intergenic
1200836741 Y:7739762-7739784 AATAATCATGCTCAGATGACAGG + Intergenic
1201431411 Y:13906582-13906604 AAAAATGATCCCCAAAAGACTGG + Intergenic