ID: 1012627963

View in Genome Browser
Species Human (GRCh38)
Location 6:101427306-101427328
Sequence CAGAGCAATGAGAATGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 558
Summary {0: 1, 1: 0, 2: 5, 3: 45, 4: 507}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012627963_1012627967 -4 Left 1012627963 6:101427306-101427328 CCATCCCCATTCTCATTGCTCTG 0: 1
1: 0
2: 5
3: 45
4: 507
Right 1012627967 6:101427325-101427347 TCTGCTTTTCTGAAATTCTGTGG 0: 1
1: 0
2: 3
3: 56
4: 478
1012627963_1012627968 20 Left 1012627963 6:101427306-101427328 CCATCCCCATTCTCATTGCTCTG 0: 1
1: 0
2: 5
3: 45
4: 507
Right 1012627968 6:101427349-101427371 TCATCTAAATAATCCTGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012627963 Original CRISPR CAGAGCAATGAGAATGGGGA TGG (reversed) Intronic
900706412 1:4082962-4082984 CTTAGCATTGAGGATGGGGAGGG + Intergenic
902140372 1:14348737-14348759 CAAAGCCATGAGAATCAGGATGG + Intergenic
902769468 1:18637262-18637284 GAGGGCAATGAGGAAGGGGAGGG - Intronic
902806663 1:18865391-18865413 CACAGGTATGAGCATGGGGACGG - Intronic
903581601 1:24374965-24374987 CCTAGGAATGAGGATGGGGATGG - Intronic
903686331 1:25134970-25134992 CAGGGCAATGGGGATGGGGAGGG - Intergenic
903854846 1:26331047-26331069 CAGACCAGTGAGAAGGGGCAAGG - Intronic
903935567 1:26892582-26892604 GGGAGCAGGGAGAATGGGGATGG + Intronic
904491711 1:30864565-30864587 CAGAGCCTTGAAAATGGGCAGGG + Intergenic
904597174 1:31654166-31654188 CAGGGCAAGGAGTATGGGGGTGG + Intronic
904619868 1:31768688-31768710 CAGAGCAATGAGTATTGCCAAGG - Intergenic
904807737 1:33143572-33143594 AAGAGGAATGAGAACGAGGATGG - Intergenic
906222312 1:44090650-44090672 CAGAGCACTGACCACGGGGAGGG + Intergenic
907303694 1:53502701-53502723 CAGAGAGAGGAGAGTGGGGAGGG + Intergenic
907646921 1:56253556-56253578 CAGAGCATTGACAATGGGGATGG - Intergenic
907913297 1:58846101-58846123 CAGAGGAAACAGCATGGGGAAGG - Intergenic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
910238020 1:85055805-85055827 CGGAGAAAGGAGAATGAGGAAGG + Intronic
910487919 1:87736253-87736275 CTGAGCAATGAGACTGGGGCAGG + Intergenic
911168394 1:94745398-94745420 CAGAGCAGTGGGAATGGGGATGG + Intergenic
912413551 1:109493648-109493670 AAGAGCAAGGAGAATAGGAAAGG - Intergenic
912510001 1:110182922-110182944 CAGAGAAATGAGAAATGGGATGG + Intronic
912690034 1:111797993-111798015 CAAGGCAATGACACTGGGGATGG + Intronic
913282217 1:117197312-117197334 GAGAGCAATGAGAAGGGGGAGGG - Intronic
916257494 1:162804599-162804621 CAGAGCAATGGGAAGCTGGAGGG + Intronic
916271120 1:162942638-162942660 CAGATTAATGATAATGGTGATGG + Intergenic
916478515 1:165193414-165193436 GAGAGCAATGGGAATGGGAATGG - Intergenic
916668004 1:166984323-166984345 CAAAGCATTAAGAATGGGCATGG - Intronic
916810354 1:168300261-168300283 CGAAGGAAGGAGAATGGGGAAGG + Intronic
916877840 1:168988691-168988713 CAGAGCAATTAGACAAGGGAAGG + Intergenic
916894751 1:169151168-169151190 TAGAGCAATGAGGGTGGAGATGG - Intronic
917521857 1:175754304-175754326 CAGAGCAAGGAAGATGGGGTTGG - Intergenic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
919547686 1:198943973-198943995 CAGTGCAATGAGAGAGGGGTGGG - Intergenic
920007924 1:202846883-202846905 CAGAGCAGTGAGATGGGGGAGGG - Intergenic
920778984 1:208969608-208969630 GATAGCAAAGAGAAGGGGGAGGG + Intergenic
920846710 1:209599420-209599442 CATAGCAATGAGAAGGCAGATGG - Intronic
921114459 1:212074979-212075001 CAGAGAAAAGAGGATGGGGTGGG - Intronic
921257174 1:213352991-213353013 CAGAACAATGTGAGAGGGGAGGG + Intergenic
921945979 1:220886459-220886481 AAGAGCAGTGAGAATGGAGTAGG + Intergenic
922378976 1:225001607-225001629 CATAGATATGAAAATGGGGAGGG - Intronic
923429933 1:233910207-233910229 CAGAGAAATGAGAAAGGAAAAGG - Intronic
924657337 1:245984899-245984921 CAGAGCAAGGAGAAGTCGGATGG - Intronic
1063800364 10:9570415-9570437 CAGAGCACTGATACAGGGGAAGG - Intergenic
1066334558 10:34462987-34463009 GGGAGGAAAGAGAATGGGGAGGG + Intronic
1066674199 10:37871515-37871537 CAGAGAAATGACAATGTGGCAGG - Intergenic
1066700553 10:38123122-38123144 CAGGGCAAAGAGAGGGGGGAAGG + Exonic
1066723943 10:38370285-38370307 CAGAGCAATGGGAAGCTGGAGGG + Intergenic
1067019712 10:42784196-42784218 GAGAGAAATGAAATTGGGGATGG + Intronic
1067499386 10:46788226-46788248 GAGAGAAATGAAATTGGGGATGG + Intergenic
1067512349 10:46906497-46906519 GAGAGCAAAGAGAAAGAGGATGG + Intergenic
1067595243 10:47552096-47552118 GAGAGAAATGAAATTGGGGATGG - Intergenic
1067649894 10:48145325-48145347 GAGAGCAAAGAGAAAGAGGATGG - Intergenic
1067784137 10:49230128-49230150 TTGAGCCAGGAGAATGGGGAGGG + Intergenic
1069529344 10:69204629-69204651 CAGAGGACTAAGATTGGGGAGGG - Intronic
1069649242 10:70032241-70032263 CAGAGCAATGCAGATAGGGATGG - Intergenic
1069902932 10:71716212-71716234 CAGGGCGATGAGCATGGGGAGGG + Exonic
1069987326 10:72293308-72293330 AAGAGGAAGCAGAATGGGGAGGG - Intergenic
1070870294 10:79745369-79745391 CACAGCAAGGAGAATGTGGCAGG - Intergenic
1070905977 10:80073496-80073518 CAGTATAATGAGAATGGAGAAGG - Intergenic
1070978886 10:80628540-80628562 GAGGGCAAAGTGAATGGGGAAGG + Intronic
1071637213 10:87267589-87267611 CACAGCAAGGAGAATGTGGCAGG - Intergenic
1074378006 10:112954018-112954040 CAGAGCAGTGGAAATGAGGATGG + Intronic
1074899860 10:117806687-117806709 CAGAGCATTGAGAACGTGCAGGG + Intergenic
1074975517 10:118577978-118578000 GAGAGCTATCAGAATGGGGAAGG + Intergenic
1075272188 10:121061909-121061931 CAGATCATGGAGGATGGGGAAGG + Intergenic
1076030137 10:127150336-127150358 CTGAGCAAAGAGAAAGGGGAGGG - Intronic
1076082951 10:127600011-127600033 GAGAACACAGAGAATGGGGAGGG + Intergenic
1076884547 10:133255716-133255738 CAGAGCCATGTGACCGGGGAGGG - Intergenic
1076923142 10:133465940-133465962 CAGAGCACAGAGAATGGGAGTGG - Intergenic
1077154686 11:1086047-1086069 CAGGGCAGTGAGACTGGTGAGGG - Intergenic
1077401943 11:2363228-2363250 CAGACCCATCAGAATGGGGCTGG - Intergenic
1077606449 11:3615998-3616020 AAGAGCAGTGAGGATGGGGCCGG + Intergenic
1077909573 11:6562466-6562488 CAAAGCCATGAGATTAGGGAGGG + Intronic
1078007261 11:7541286-7541308 CAGTGCAGAGTGAATGGGGAGGG + Intronic
1078100649 11:8328612-8328634 CAAAGCACTGAGAATGTGGATGG - Intergenic
1078236940 11:9493932-9493954 AAAAGCAATGAGAAAGGGGTAGG - Intronic
1078460172 11:11509090-11509112 CAGAGGATTCAGAATGGGCAAGG - Intronic
1078575059 11:12494309-12494331 CCGACCCATGAGAAAGGGGAAGG - Intronic
1079162099 11:18004881-18004903 GAAAGCAGTGAGGATGGGGAAGG - Intronic
1080317220 11:30963938-30963960 AACAGCAATGAGAATTAGGAAGG - Intronic
1080331214 11:31141379-31141401 CAGAGCAATGAGAGTTTGGTTGG - Intronic
1082657055 11:55869002-55869024 CTGAGCAAAGAGAAGGGGGTGGG + Intergenic
1083105024 11:60349006-60349028 CAGAGTGAAGAGAATGGGGTGGG + Intronic
1083402450 11:62433304-62433326 AAGAGGAAAGAGAAAGGGGAGGG + Intergenic
1083973335 11:66096994-66097016 CAAAGAAATGAAAATGGGGCTGG - Intronic
1085169573 11:74437537-74437559 CAGCGCAATGAGTAAGGGAAGGG + Intergenic
1085753964 11:79188653-79188675 AAGAGAAGTGAGGATGGGGATGG + Intronic
1085923803 11:80990557-80990579 CAGTGCTATGAGAAGGGGCAAGG - Intergenic
1086398355 11:86440554-86440576 CAGAGAAATGTGGGTGGGGAGGG - Intergenic
1087022781 11:93619903-93619925 CAAAACAATGGGAATGGGGGAGG - Intergenic
1087074053 11:94112106-94112128 CAGAAAAAGGAGAATGGGCATGG + Exonic
1088187764 11:107192574-107192596 CAGAGAAAAGAGGATGGGTATGG - Intergenic
1089360852 11:117885559-117885581 GAGAGGGATCAGAATGGGGATGG + Intergenic
1089884540 11:121806928-121806950 CTGAGCGAAGAGCATGGGGATGG + Intergenic
1090413360 11:126524014-126524036 GAGAGTAATGATAATGTGGAAGG - Intronic
1090431958 11:126653679-126653701 CAGGGCAATGAGAAACGGGAGGG + Intronic
1090437048 11:126695737-126695759 CAGAGCTCTGAGAGAGGGGAAGG + Intronic
1090480277 11:127061760-127061782 CAAAGAAAGGAGAAGGGGGAAGG - Intergenic
1090800451 11:130168202-130168224 AAGAGCAAACAGAATGAGGAAGG + Intronic
1091485714 12:885691-885713 CAGGACAATGAGTATGGGGCTGG - Exonic
1091813912 12:3421830-3421852 CAGAGCCATGAGCAACGGGATGG + Intronic
1092170928 12:6373776-6373798 CAGAACAAGGAGAATGGGTCAGG - Intronic
1092860063 12:12712609-12712631 CAAAGCAAGGAGAAAGAGGAAGG - Intergenic
1092902114 12:13069724-13069746 CAGAGAGATGAGAATGAGGTCGG + Intronic
1093089294 12:14903860-14903882 CAGAGAAATGAGACTTGTGAAGG + Intronic
1093091109 12:14921348-14921370 CAGATAAATGAGGATGAGGAAGG + Intronic
1093261794 12:16947956-16947978 GAGAGAAAGGAGAGTGGGGATGG - Intergenic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1093278194 12:17155017-17155039 CAGAGCAATCAGACAAGGGAAGG + Intergenic
1093281695 12:17203738-17203760 CAGAGCAAGGGGGATGGGGGGGG - Intergenic
1093558480 12:20508126-20508148 CAGTGCAATGAGAATGTGCCTGG - Intronic
1093822776 12:23642601-23642623 GAGATCAATGGGATTGGGGAGGG + Intronic
1095651881 12:44620759-44620781 CAGAGCAATGGGGATAGAGATGG - Intronic
1096665165 12:53159715-53159737 GAGAGGAATGAGAAAGAGGAAGG + Intronic
1097029906 12:56082671-56082693 CAGAGGAAAGAGACTGGGGTAGG + Intronic
1098909830 12:76197596-76197618 AAGAACAATGGGAGTGGGGAGGG + Intergenic
1099576679 12:84392046-84392068 CAAAGCCATGAAAAAGGGGAAGG - Intergenic
1099877515 12:88427414-88427436 CAGAGGCAGGAGTATGGGGAAGG + Intergenic
1100085372 12:90903999-90904021 AAGAGCTATCATAATGGGGAAGG - Intergenic
1100591946 12:96037500-96037522 CAGTGGGGTGAGAATGGGGAAGG + Intronic
1100708557 12:97228693-97228715 AAGAGTTATGAGAAAGGGGAAGG - Intergenic
1101084902 12:101225956-101225978 CTAAGCAATGAGAAGGAGGAGGG - Intergenic
1101261575 12:103037324-103037346 TAGGGTAATGAGAATTGGGAGGG + Intergenic
1101809712 12:108097030-108097052 CAGAGGAATTAAAATGGGCAGGG - Intergenic
1101810392 12:108102833-108102855 TAAAGCAATGAGTTTGGGGATGG + Intergenic
1103747285 12:123133975-123133997 CAGAGTAATGAGGCTGGGGCCGG - Intronic
1105773842 13:23638468-23638490 AAAAGCAATGACCATGGGGAGGG - Intronic
1105957326 13:25296184-25296206 CAGAGCAAAGGGAATTGGGCAGG + Intergenic
1105962641 13:25356046-25356068 AAGAAAAATGAGAACGGGGAGGG - Intergenic
1107158152 13:37193883-37193905 CAGAGCAGTGTCAATGGGTATGG - Intergenic
1107217053 13:37934328-37934350 CAGCACAAGGAGAATGGAGAAGG + Intergenic
1108702403 13:52954909-52954931 CAGAGGAATGAGGGTGGGAATGG + Intergenic
1109272390 13:60268831-60268853 CAGAGTAGTGAGAAAGGGGAAGG + Intergenic
1109854793 13:68112334-68112356 CAGAGCAATCAGAAAAGAGAAGG + Intergenic
1110380167 13:74841262-74841284 CAGAGGAATCAGAATGGAGGGGG - Intergenic
1111234672 13:85393246-85393268 CAGGGAAATGAAAATGGAGAGGG + Intergenic
1111777396 13:92681668-92681690 GAGAGAAATGAGAATTAGGAGGG - Intronic
1111835418 13:93382941-93382963 CAGAGGAATGAGAGAGGGAAAGG - Intronic
1111944282 13:94647495-94647517 CAAAGGAATGAGAAAGGGGATGG + Intergenic
1112018916 13:95354594-95354616 CAGAGCAGGTAGAATGTGGAAGG - Intergenic
1112066900 13:95802749-95802771 CAGAAGAATGAGAGTGGGGTGGG - Intronic
1113801228 13:113087391-113087413 AAGAGGGAGGAGAATGGGGAGGG + Exonic
1114382658 14:22224404-22224426 CAGCTGAATGGGAATGGGGAAGG - Intergenic
1114525388 14:23364771-23364793 AAGAAAAAGGAGAATGGGGAGGG + Intronic
1115270131 14:31542148-31542170 TAGAACAGTGAGAAAGGGGATGG - Intronic
1116762711 14:49033906-49033928 GAGAGCCATGAGACTGGAGAAGG - Intergenic
1117060257 14:51954984-51955006 TAGAGGAATGGGAATGGGAATGG + Intronic
1117099676 14:52333575-52333597 GAGGGCAAAGGGAATGGGGAGGG - Intergenic
1117292538 14:54347562-54347584 CAGAGGACTGAGAAATGGGAAGG + Intergenic
1118137098 14:63042142-63042164 CAGAGCAGAGAGAAAGGGGTGGG - Intronic
1118779270 14:68995791-68995813 TAGAGGAAAGAGAATTGGGAGGG - Intergenic
1119114906 14:72010528-72010550 CACAGGAATGAGTATGGGGTGGG - Intronic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1119770707 14:77219203-77219225 CTCAGCAATGAGAAAGAGGAAGG - Intronic
1119843530 14:77811085-77811107 GAGAGCAAGGAGAAAGGGTAGGG + Intronic
1120850223 14:89162973-89162995 CAGAGCGAGGACAGTGGGGAGGG + Intronic
1121096707 14:91222339-91222361 CAGAAGGATGAGAATGGTGAGGG + Intronic
1121953139 14:98189689-98189711 CACAGCAGTGAGGATGGAGAAGG + Intergenic
1122021484 14:98841470-98841492 AAGAGCAAAAAGAATTGGGAGGG + Intergenic
1122334593 14:100962567-100962589 CTGAGCAAAGGAAATGGGGAAGG + Intergenic
1122369593 14:101222030-101222052 CAGATCCATGAGGATGGGGCAGG - Intergenic
1123433275 15:20236230-20236252 CTGGGCAATGGGAGTGGGGAGGG - Intergenic
1123866350 15:24523278-24523300 CAAAGGACTGAGAATGTGGAGGG + Intergenic
1123964638 15:25442746-25442768 CAGAGAACCAAGAATGGGGAGGG - Intergenic
1124006854 15:25801502-25801524 CAGAGCACTGAGAATGAGGGCGG + Intronic
1124186401 15:27533380-27533402 CAGAGAAAGGAGACTGGGGTTGG - Exonic
1124582950 15:30978031-30978053 CAGAGCAGTGAGGGTGAGGAAGG - Intronic
1124889604 15:33720378-33720400 CAGAGGAATGGGGATGGGGTGGG - Intronic
1124972576 15:34503218-34503240 GAGAGAAATGAGAATTAGGAGGG - Intergenic
1125720224 15:41841782-41841804 CAGAGCAGAGAGGCTGGGGACGG - Intronic
1125758031 15:42078331-42078353 GAGTGAAATGAGACTGGGGAGGG + Intronic
1126357577 15:47812613-47812635 AAGAGAACTGAGAAGGGGGATGG + Intergenic
1126504805 15:49392362-49392384 CAGTGGAATGTGCATGGGGAAGG + Intronic
1126957945 15:53955768-53955790 AAGAGGCATCAGAATGGGGAAGG - Intergenic
1128134411 15:65252187-65252209 AAGACCAATGAGAGTGGGAAAGG + Intronic
1128667565 15:69549626-69549648 CAGAGTAATGAGATAGGGCATGG + Intergenic
1128806958 15:70538274-70538296 CACAGCACTAAGAGTGGGGAAGG + Intergenic
1129158641 15:73734321-73734343 CAGAGAAATGGAAAGGGGGAAGG + Intergenic
1129429942 15:75492515-75492537 CAGGACAATGAGAATGGGTCAGG - Intronic
1130112602 15:80977924-80977946 CAGAGAACTGAGAATGCAGAGGG + Exonic
1130226006 15:82058867-82058889 GAGAGGAAGGAGAAGGGGGAAGG - Intergenic
1130862965 15:87907862-87907884 CATAGAAATTAAAATGGGGAGGG + Intronic
1131177240 15:90217744-90217766 CTGGGGAATGAGAAAGGGGAAGG - Intronic
1131179567 15:90230723-90230745 CAGAGCAATGACAATGGCAGTGG + Intronic
1131439286 15:92446872-92446894 GTGAGCAAGGAGAAAGGGGAAGG + Intronic
1132107637 15:99074761-99074783 CAGAGCAATGGGTATGGGCAGGG + Intergenic
1133747620 16:8699216-8699238 CAGAGGGAAGAGATTGGGGAGGG + Intronic
1135494513 16:22939832-22939854 CAGAGGAGTGAGAATGTGGGAGG + Intergenic
1135494560 16:22940087-22940109 CAGAGGAGTGAGAATGTGGGAGG + Intergenic
1135922494 16:26663634-26663656 CGGAGGAATGAAGATGGGGAGGG + Intergenic
1136851350 16:33614892-33614914 CTGGGCAATGGGAGTGGGGAGGG + Intergenic
1137023789 16:35454358-35454380 CAGAGCAGTGTGAGTGGGGGAGG - Intergenic
1137518412 16:49170851-49170873 CAGAGCAAGGAGAAAGTTGAAGG - Intergenic
1137968830 16:52963470-52963492 CAGAGCCAGGGGAATGGGGTGGG - Intergenic
1139221163 16:65183676-65183698 CAGAGAAATCAGAGTGAGGATGG - Intergenic
1139343497 16:66287305-66287327 CAGAACAATGATCATGCGGATGG + Intergenic
1139557757 16:67723575-67723597 CAGACCCATGAGGATGGGGATGG + Exonic
1140328777 16:74031581-74031603 CAGTGCAATGAGAATCGAGAAGG - Intergenic
1140367991 16:74396592-74396614 CATAGCAATGAGACATGGGAAGG - Intergenic
1141246302 16:82310810-82310832 CAGAGCCATGACAATGTGGAGGG - Intergenic
1142085535 16:88178245-88178267 CAGGGAAATGAGAGAGGGGAGGG + Intergenic
1143359925 17:6361154-6361176 CAGAGCAATAAGATTGGATAGGG - Intergenic
1143481342 17:7229217-7229239 CAGAGCAATGAGCGGGGAGACGG - Exonic
1143769913 17:9162042-9162064 CTGAGCAATGCTCATGGGGAGGG + Intronic
1143934975 17:10474203-10474225 CAGAACAATGAAAAAGTGGAGGG + Intergenic
1144387801 17:14766055-14766077 TAGAGCACTGAGTATGAGGAAGG - Intergenic
1144459470 17:15446445-15446467 AAGGGCAATGGGAGTGGGGAGGG + Intronic
1144853457 17:18255612-18255634 CAGAGAAATCAGAATCTGGATGG + Intronic
1145902410 17:28497302-28497324 CAGAGGAGTGGGAATGGGGTGGG - Exonic
1146267779 17:31464407-31464429 GAGAGCAGAGAAAATGGGGATGG + Intronic
1146667510 17:34714968-34714990 CAGAGAAAGAAGAATGGGTAGGG + Intergenic
1147112958 17:38277451-38277473 CAGAGGAAGGAGAATGGGGTGGG - Intergenic
1147326370 17:39671653-39671675 CAGAGGAAGGAAAATGGGGATGG - Exonic
1148416663 17:47511774-47511796 CAGAGGAAGGAGAATGGGGTGGG + Intergenic
1148633258 17:49128404-49128426 CAGAGGGATGAGAATGCAGAGGG + Intergenic
1149029608 17:52068051-52068073 CAGAGACATGAGGATTGGGAGGG + Intronic
1149468475 17:56897777-56897799 CAGAGGAAGGTGACTGGGGAAGG + Intronic
1151306623 17:73266871-73266893 CAGAGCATTAATAAAGGGGAAGG - Intergenic
1151444914 17:74157081-74157103 AAGAGCAATGCCAATGGGGTAGG + Intergenic
1152163382 17:78683822-78683844 CCTAGAAGTGAGAATGGGGAGGG - Intronic
1153096981 18:1418286-1418308 CAGAGAAATGAGAAGGGAGCTGG + Intergenic
1154099975 18:11463890-11463912 CAGAAGAATGAGTATGAGGAAGG - Intergenic
1154341342 18:13504986-13505008 CACTGCCATGAGGATGGGGACGG + Intronic
1155326163 18:24666963-24666985 GAGAGGAAAGAGAAAGGGGAAGG - Intergenic
1156163528 18:34389515-34389537 CAAAGCACTGAGATTTGGGAGGG - Intergenic
1156573629 18:38286685-38286707 CAAAGCAAGGAGAATAGGTAAGG - Intergenic
1156614613 18:38768839-38768861 AAGAGCAAGGAAAATGGAGAAGG + Intergenic
1157197518 18:45631389-45631411 CAGAGCAATTAGAAAGGTCAAGG + Intronic
1157264669 18:46207896-46207918 CAGAGCACTAAAAATGGGGTAGG - Intronic
1157304853 18:46509425-46509447 CAGAGACCTGAGAAAGGGGAGGG - Intronic
1157370863 18:47110035-47110057 GAGAGCAAGGAGAAAGGTGAAGG - Intronic
1158419538 18:57280470-57280492 CAGAGCAATGTGACTGAAGATGG + Intergenic
1158488740 18:57891328-57891350 GAGAGCAACCAGAATGGGGTGGG - Intergenic
1158864075 18:61620289-61620311 CAGAGGGATGAGAATAGAGAAGG - Intergenic
1159261841 18:66023743-66023765 CACAGCAATGAGAATGAGTAGGG + Intergenic
1159705973 18:71688192-71688214 CACAGCAAAGAGAAGGGGAAAGG + Intergenic
1159880904 18:73857642-73857664 CAGAGGGATGAGGATGGAGAAGG + Intergenic
1160048839 18:75412864-75412886 AACAGCAATGAGACTGGGGGAGG - Intronic
1162667035 19:12222393-12222415 CAGTGAAATGAGAACTGGGAAGG - Intergenic
1162781105 19:13007431-13007453 CAGGGCAATCAGAAATGGGAGGG - Intronic
1163092736 19:15032370-15032392 GAGAGCACTGAGAATGGAGTCGG - Intergenic
1163460808 19:17436475-17436497 CAGACCAGGGAGCATGGGGAAGG - Exonic
1164581343 19:29437225-29437247 CAGATGAATGGGAATGGAGAAGG + Intergenic
1164672632 19:30081548-30081570 CAAAGCAGAGAGAATGGGAAGGG - Intergenic
1165580447 19:36858242-36858264 CAAAGCAGTGAGAATGGAGAAGG + Intronic
1165822047 19:38682913-38682935 CGGAGTAATGTGACTGGGGAGGG - Intronic
1165829517 19:38723577-38723599 GAGAGCAATGAGACTCGGCAAGG - Intronic
1166590317 19:43991994-43992016 CAGAGCAATGCAAATGGGCATGG - Intronic
1166881041 19:45930289-45930311 CAGAGGAAGGAGAATAGAGATGG - Intergenic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167498202 19:49831292-49831314 GAGGGCCATGAGAATGGGGAAGG - Intronic
1167637513 19:50663447-50663469 CAGAGTAATGAAAGTGGAGAGGG - Intronic
925490089 2:4381908-4381930 CAGAGCCATATGAATGGGCATGG - Intergenic
926289028 2:11514038-11514060 CAGTGCAGAGAGGATGGGGATGG + Intergenic
927044784 2:19266129-19266151 CAGAGAACTGAGCATGTGGAAGG - Intergenic
928582302 2:32721430-32721452 CAAAGATATGAGAATGAGGATGG - Intronic
928943756 2:36753701-36753723 CAGAGCCATGGGAGTGGGAATGG + Intronic
929272772 2:39991152-39991174 CTAAGGAATGAAAATGGGGAAGG - Intergenic
929441030 2:41965907-41965929 CAGAGGAGAGAGAGTGGGGATGG + Intergenic
929679159 2:43971191-43971213 CATAGAAATGAGAATGTGAAAGG - Intronic
929828540 2:45329274-45329296 GAGAGCAATGAGGATGGGAATGG - Intergenic
932176241 2:69605385-69605407 CAGAGCAAGGAGAATGGTTAGGG - Intronic
935170313 2:100606491-100606513 CAGAGAAAGGAGGCTGGGGAGGG - Intergenic
937168235 2:119841719-119841741 CTGAGTAATGAGCATGGGAAGGG - Intronic
937681497 2:124649410-124649432 CAACGCAATGAGAAGAGGGAAGG - Intronic
938021255 2:127907544-127907566 AAAAGCAATGAGAATGGGCTGGG + Intergenic
939144257 2:138393906-138393928 CAGAGGAAGGTGAATGCGGAAGG - Intergenic
939275507 2:139992479-139992501 GGGAGCAAAGAGATTGGGGACGG - Intergenic
939535265 2:143420200-143420222 CACAGCAATGATAATGGGCTAGG + Intronic
940413281 2:153390946-153390968 CAGGGTAAGGAGAATTGGGAGGG + Intergenic
941584667 2:167342684-167342706 CAGAGGAACAAGGATGGGGAGGG - Intergenic
941739838 2:169023806-169023828 AAGTGGAATGAGACTGGGGAGGG + Intronic
942676217 2:178429140-178429162 CAGAAGAATGAGAATGGGCCAGG - Intergenic
943173526 2:184435570-184435592 AAGAGTAAAGAGAATGTGGAAGG + Intergenic
946037320 2:216754543-216754565 CAGAGCAGCTTGAATGGGGAAGG - Intergenic
946359932 2:219213169-219213191 CAGAGCACTGAGAAGCAGGAAGG + Intronic
946736824 2:222762117-222762139 CCAAGCAATGGGAATGGGGAGGG + Intergenic
948028839 2:234800144-234800166 CAGAGCAAGGAGGATGGAGCTGG + Intergenic
948241778 2:236443812-236443834 CAGAGAAAAGGGAATGTGGAAGG - Intronic
948467264 2:238158522-238158544 CGCAGCCAGGAGAATGGGGAGGG + Intergenic
948960871 2:241335805-241335827 CAGAGAAGTCAGAAAGGGGAAGG - Intronic
1168854770 20:1001004-1001026 CTGAGCAAGGATAAAGGGGAAGG - Intronic
1169525287 20:6417658-6417680 CAGGACAATGAGGAAGGGGAAGG + Intergenic
1170323183 20:15124747-15124769 CAAAGAAATGAGATGGGGGAAGG - Intronic
1170447847 20:16448113-16448135 AAGAGCAATATCAATGGGGATGG - Intronic
1171069752 20:22057069-22057091 CAGAGGTATGTGAATGGCGATGG + Intergenic
1171313768 20:24167721-24167743 CAAAGCAATGAGGCTGAGGAAGG + Intergenic
1171777963 20:29388312-29388334 CAGAGCCAGTAGAATGTGGAGGG - Intergenic
1171801444 20:29623493-29623515 CAGGGCAATCAGAAAGGAGAAGG + Intergenic
1172011149 20:31846632-31846654 CAGAGCTAGGAGGATGGGGTAGG - Intergenic
1172032427 20:31991294-31991316 CAGAGCCATGGGAAGGGGAAGGG + Intronic
1172324898 20:34026729-34026751 CAGAGAAAAGAGGATGGGAAAGG - Intronic
1172765982 20:37351129-37351151 CAGAGCAAGGAGTAGGGAGATGG - Intronic
1173114719 20:40230295-40230317 GAGAGCAAAGAGAAAGGGGCAGG + Intergenic
1173468042 20:43299978-43300000 CAGAGCCATGTGAAAGTGGAAGG + Intergenic
1175225536 20:57441874-57441896 CAGAGGAATGGGCAGGGGGAGGG + Intergenic
1176070283 20:63222632-63222654 GACAGGAATGAGAATGGGCAGGG + Intergenic
1176093902 20:63330870-63330892 CAGAGCCAAGAGTATGGGGTGGG - Exonic
1176648331 21:9371455-9371477 CTGGGAAATAAGAATGGGGAGGG - Intergenic
1176744048 21:10635213-10635235 CAGAGCAATCAGACAGGAGAAGG + Intergenic
1178564929 21:33675216-33675238 TAGAGAAATGAGAAATGGGAGGG - Intronic
1179321029 21:40291407-40291429 GTGAGCAATGAGAGTGGTGATGG - Intronic
1179498100 21:41787505-41787527 AAGAACAATGAGAACGTGGATGG - Intergenic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1181814700 22:25429480-25429502 CAGAGCCCTGAGAAGGGGGCAGG - Intergenic
1182033015 22:27174902-27174924 CAGAGCAGGGAGAAGAGGGATGG + Intergenic
1182736153 22:32533255-32533277 CAGAGCATTGAGGATTTGGAAGG - Intronic
1183478065 22:38046753-38046775 CAAAGCAGTGTGTATGGGGAGGG + Intergenic
1184383442 22:44160772-44160794 CAGAGCAATGAGGCTTGGAAGGG + Intronic
1185385736 22:50530663-50530685 CAGAGTCAGGAGAGTGGGGAGGG - Intronic
949547695 3:5086193-5086215 CAGAGCAATGGGAATGGAGAAGG + Intergenic
949901808 3:8821361-8821383 CAGAGCAGAGAGAATGGATAGGG - Intronic
949967009 3:9365403-9365425 CAGAGCAATGAAAATCAGAAAGG - Intronic
950460888 3:13121708-13121730 GAGAGCAGAGAGAATGGGGCAGG + Intergenic
951219801 3:20057091-20057113 CCTGGCAATGAGAATGGAGAAGG + Intronic
951477954 3:23128753-23128775 CAGAGTGAAGAGAAAGGGGAAGG - Intergenic
951865521 3:27302781-27302803 CCCTGCAATGAGCATGGGGAAGG + Intronic
952711788 3:36439101-36439123 CAGTGGAAAGAGCATGGGGACGG + Intronic
953044505 3:39282500-39282522 CAGAGAAATGAGAGTGTGGTGGG + Intergenic
953139080 3:40210826-40210848 CAGAGCACTGACAATGGGGAGGG - Intronic
953474298 3:43193038-43193060 GAGTGAAATGAGAATGGTGAGGG - Intergenic
953576958 3:44120624-44120646 GAGAGCAAACAGAATGGGCAAGG + Intergenic
953620498 3:44528627-44528649 CAGCGCAGTGAGTGTGGGGAAGG + Intergenic
954550931 3:51481083-51481105 CACAGCTATGATATTGGGGATGG - Intronic
955088078 3:55722197-55722219 CAGAGATAAGAGAATGGGGTTGG + Intronic
955285416 3:57636494-57636516 CAGAGAAATGACAATATGGAGGG + Intronic
955796703 3:62644733-62644755 TTGAGCAATGGGAGTGGGGATGG - Intronic
955904581 3:63793437-63793459 CAGAGAAATGTGAAAGGGAAAGG - Intergenic
955947702 3:64210927-64210949 CAGAAGAATGAAAGTGGGGAAGG + Intronic
956226218 3:66961999-66962021 CAGCCCAAGCAGAATGGGGAGGG - Intergenic
956542791 3:70361516-70361538 CAGCGAGATGAGAGTGGGGAAGG - Intergenic
956803543 3:72786163-72786185 CAGGTGAGTGAGAATGGGGAAGG - Intronic
956939922 3:74146664-74146686 CAAAGCAGTGAGGATGGAGAAGG - Intergenic
957238988 3:77633858-77633880 CAGAGCAGTGAGAACGTGCAAGG + Intronic
957239826 3:77644020-77644042 GGGAGCAATGAGAATAGAGAGGG + Intronic
957825886 3:85443412-85443434 CAGAGAAATGGGAATGAGGCTGG - Intronic
959650410 3:108745377-108745399 CACAGGAATGAGCATGGGGGAGG + Intronic
959860732 3:111212083-111212105 GAGAGCAGGAAGAATGGGGAAGG - Intronic
960042124 3:113161469-113161491 TAGTGCAGTGAGAAAGGGGAGGG + Intergenic
960243295 3:115371142-115371164 GAGAGAAAGGAGAATGTGGAAGG - Intergenic
960943009 3:122946805-122946827 CAAAGCTGTCAGAATGGGGAAGG + Intronic
960947001 3:122973795-122973817 CAGAGGTATGGGAGTGGGGAAGG + Intronic
961624849 3:128254764-128254786 CAGAGTCCTGAGAGTGGGGAGGG + Intronic
962076069 3:132082748-132082770 AACAGCTATGAAAATGGGGAGGG - Intronic
962246719 3:133801545-133801567 CAGAGCTATGTGAATGAAGAGGG - Intronic
962306048 3:134287285-134287307 CAGTGCAATGAGCAGGGGGATGG - Intergenic
962432299 3:135330470-135330492 CGAGGCAATGAGAAAGGGGAGGG - Intergenic
962978817 3:140469603-140469625 CAGAACAGTAGGAATGGGGATGG - Intronic
963134261 3:141886296-141886318 CAGAACGAAGAGATTGGGGAAGG - Intronic
963135412 3:141899083-141899105 GAGAGGAATGGGAATGGGTATGG + Intronic
963888172 3:150603716-150603738 TAGAACAGTGGGAATGGGGAAGG + Intronic
964181725 3:153895612-153895634 CAGAATAATGAGAATGTGGAAGG - Intergenic
964749623 3:160042323-160042345 CAGTGGAATGGGAGTGGGGAGGG + Intergenic
964843578 3:161022277-161022299 AACAGCACAGAGAATGGGGAGGG - Intronic
964922545 3:161914866-161914888 CACCGCAATGCGAAGGGGGAGGG + Intergenic
965278447 3:166718064-166718086 CAGAGCAATCAGACAGGAGAAGG + Intergenic
965528548 3:169747334-169747356 CAGAGCAAAGAAGGTGGGGAGGG + Intergenic
966260670 3:177974893-177974915 CAGAGCAATGAAAATGATTATGG - Intergenic
966921265 3:184613145-184613167 CCGGGCAACCAGAATGGGGAGGG + Intronic
967407883 3:189137758-189137780 CAGAGACACGAGAAGGGGGAAGG - Intronic
967727028 3:192871671-192871693 CAGAGCCAAGAGAATGAAGAGGG + Intronic
1202738551 3_GL000221v1_random:33529-33551 CTGGGAAATAAGAATGGGGAGGG + Intergenic
969095450 4:4729236-4729258 CAGGGCAATGAGACAGGGGTAGG - Intergenic
969294523 4:6262012-6262034 CAGGGAACTGAGCATGGGGAGGG - Intergenic
969324323 4:6432165-6432187 CATAGCCATGAGGATGGGGAGGG - Intronic
970321765 4:14881791-14881813 AAGAGCAGTGAGATTGGTGAGGG + Intergenic
970963583 4:21901883-21901905 CAGATCAATGGGATCGGGGAGGG - Intronic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
971328396 4:25662914-25662936 CAGAACAATGAAAAGGGGGAGGG - Intronic
971375044 4:26049762-26049784 GAGAGAAATGGGAGTGGGGAGGG - Intergenic
971493111 4:27235327-27235349 CAGAGAAAAGACAGTGGGGATGG - Intergenic
971500584 4:27314023-27314045 CAGAGCAATCAGAGAAGGGATGG + Intergenic
973580464 4:52339410-52339432 CAAAGCTATGAGGATGGGGTGGG + Intergenic
974393728 4:61308118-61308140 CAGACCTATGAGAAAGGGAAAGG + Intronic
974817997 4:67031037-67031059 CAAAGAAATGGGAATGTGGAGGG + Intergenic
974838442 4:67276927-67276949 CAAAGCCATCAGAAAGGGGAAGG - Intergenic
975948846 4:79743375-79743397 CAGGTCAATGAGGATGGAGAAGG - Intergenic
976032088 4:80768576-80768598 CAAATCAATGAGAATAGGCATGG - Intronic
976838963 4:89408614-89408636 CAGAGTAGTGATACTGGGGAAGG - Intergenic
977005868 4:91569233-91569255 CAGAGCAATGAGAAGGAACATGG - Intronic
977451935 4:97209980-97210002 AAGAGTAATGAGAATGGTGATGG + Intronic
977726296 4:100300670-100300692 CAAATCAAGGAGATTGGGGAAGG - Intergenic
977931914 4:102758869-102758891 CAGTGGAATGAGAAATGGGAAGG - Intronic
980299706 4:130972904-130972926 CAGAGGAGTTGGAATGGGGATGG - Intergenic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
980815060 4:137935179-137935201 CAGAGAACTGAGCATGGGAAGGG + Intergenic
981517672 4:145627551-145627573 TTGAGCAATGAGAATTGGTAAGG + Intronic
981554730 4:145980557-145980579 CAGTGCAATGACAGAGGGGAAGG + Intergenic
982304326 4:153914045-153914067 TACAGAAATGAGAAAGGGGAAGG - Intergenic
982440757 4:155433065-155433087 CATAGCAATCAAGATGGGGAAGG - Intergenic
982831118 4:160061844-160061866 CATACCAGTTAGAATGGGGATGG - Intergenic
983128383 4:163983003-163983025 CACATGACTGAGAATGGGGAGGG + Intronic
983197338 4:164822096-164822118 CATTGTAATGAGAATAGGGATGG + Intergenic
983271989 4:165573250-165573272 CACAGGAATGAGAATGAGAAAGG - Intergenic
984789324 4:183600448-183600470 CAGAGAAAAGGGAATGGAGATGG + Intergenic
984985842 4:185328933-185328955 CAGGGAAATGAGAATACGGAGGG + Intronic
985196846 4:187440007-187440029 AAGAGCAAAGAAAATGGGCATGG + Intergenic
985314633 4:188643641-188643663 CAGAGGATTGAGAGTTGGGAAGG - Intergenic
1202767360 4_GL000008v2_random:159722-159744 CTGGGAAATAAGAATGGGGAGGG - Intergenic
985877423 5:2610409-2610431 CCAACCAGTGAGAATGGGGAGGG - Intergenic
986865516 5:11981859-11981881 CAGAGAAAGTAGAATGTGGAAGG - Intergenic
987214638 5:15721535-15721557 CAGAGAGAGGAGAAAGGGGAAGG - Intronic
987842668 5:23240491-23240513 CAGAGCAGGGAGAAAGAGGAGGG + Intergenic
988642948 5:33061827-33061849 CAGAGCAATGTGACTGGGTATGG - Intergenic
988731574 5:33977762-33977784 CAGAGCACAGAGAATGTGGAAGG + Intronic
988975789 5:36514688-36514710 AAGAGGAATGGGAATGGGGTTGG + Intergenic
989142325 5:38213879-38213901 TAGAGAAAAGAGAATGAGGAGGG + Intergenic
989474223 5:41856212-41856234 CTGAGCAGTGGGAATGGGAATGG + Intronic
989661715 5:43806264-43806286 AAGAGGAATGAACATGGGGAGGG + Intergenic
989822974 5:45817815-45817837 AAAAGTCATGAGAATGGGGAGGG + Intergenic
992304175 5:75418829-75418851 GAGAGGAATGACAAAGGGGATGG + Intronic
992830699 5:80590698-80590720 CAGGGCAAGGAGAAAGGTGATGG + Intergenic
992912670 5:81412608-81412630 CAGATAAATGAGAATGGAGGAGG - Intergenic
992953849 5:81888022-81888044 CAGAGCAATGAGAACGGTATAGG + Intergenic
993280797 5:85921709-85921731 CAGAGCACTGAGAAAGAGCAAGG + Intergenic
993413570 5:87600354-87600376 CAGAGCATTGAGAAGGAGCATGG - Intergenic
994243792 5:97455476-97455498 AAGAGCAATTAGTATGGGGCTGG + Intergenic
994289407 5:98010641-98010663 CAGAGGTATGACTATGGGGATGG - Intergenic
995253549 5:110019885-110019907 CAGAGCACTGAGAAGGAGTATGG + Intergenic
995367307 5:111377495-111377517 CAGAGGAGTGAGAATGGAGGGGG + Intronic
995600457 5:113790168-113790190 CCAAGCAAAGAGAATGGGGCTGG + Intergenic
996134143 5:119818100-119818122 CACAGCATAGAGAATGTGGAAGG - Intergenic
996495454 5:124149693-124149715 CAGAGCAATCAGAAAAGAGAAGG + Intergenic
997299067 5:132789218-132789240 GAGAGCAAGAACAATGGGGATGG - Intronic
997630690 5:135366595-135366617 AAGAGCAAGTAGGATGGGGAGGG + Intronic
998537210 5:142944931-142944953 CTGAGCAATGGGGTTGGGGAGGG - Intronic
999350735 5:150868977-150868999 CAGAGCAATCAGAAAAGAGAAGG - Intronic
999389103 5:151177312-151177334 AGGAGCATAGAGAATGGGGATGG + Intergenic
999717319 5:154371742-154371764 CAATGCAAGGAGAATGGGGCAGG - Intronic
1002939792 6:1705896-1705918 CACAGCAATGAGAAGGGTGGCGG + Intronic
1003411355 6:5865614-5865636 GAGGGTAATGAGAGTGGGGAAGG + Intergenic
1003504144 6:6725796-6725818 AAATGCAATGAGAAGGGGGATGG - Intergenic
1003756576 6:9127838-9127860 CAGAGCAAAGAGGATGAGAAAGG - Intergenic
1004264770 6:14139735-14139757 AAGAGCAGTGAGAATGGTGAGGG + Intergenic
1004299026 6:14440468-14440490 CAGGGCACTGAAAGTGGGGAGGG + Intergenic
1004622865 6:17346552-17346574 AAGAGGAATGAGAAAGGTGAAGG + Intergenic
1005755581 6:28922989-28923011 CAGAGAAAAGAGAGTGGGGGTGG + Intronic
1005896621 6:30184732-30184754 CAGAGCACTTGGAATGGGTAAGG + Exonic
1006201890 6:32300838-32300860 CTGGGCAAAGAGAAGGGGGAAGG - Intronic
1006305015 6:33213571-33213593 CAGAGAACTGAGCATGGGGGAGG - Intergenic
1007127021 6:39433866-39433888 CTGAACAAGCAGAATGGGGATGG - Intronic
1010919792 6:81667210-81667232 CTGAGGAATGAGGATGGTGATGG + Intronic
1011184830 6:84662550-84662572 CAAAGCAGTGAGAGAGGGGATGG + Intergenic
1011384772 6:86783292-86783314 CACACCAGTGAGAATGGGAATGG - Intergenic
1011495942 6:87936660-87936682 GAAGGCAGTGAGAATGGGGAAGG + Intergenic
1012238011 6:96839667-96839689 CAGAAGAATGAGAATGCTGATGG + Intergenic
1012307599 6:97677694-97677716 CAGACCAATGAGAGTGGGAAGGG - Intergenic
1012396336 6:98801720-98801742 CAAAGCAATGACAATGAAGATGG + Intergenic
1012501950 6:99897879-99897901 CAGAGCTATTTGACTGGGGAGGG + Intergenic
1012627963 6:101427306-101427328 CAGAGCAATGAGAATGGGGATGG - Intronic
1013189630 6:107791156-107791178 CAGAGCAAGAAGAACAGGGATGG + Intronic
1014267438 6:119296865-119296887 CAGAGCCTTGAGAATGGCAAAGG - Intronic
1015111454 6:129596449-129596471 CAGAACAAGGGGAATTGGGAAGG - Intronic
1015471628 6:133612758-133612780 CAGAGAAAGGAGCATGGAGAGGG - Intergenic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1016798940 6:148148888-148148910 CAGAGGGATAAGAATGGAGAGGG - Intergenic
1016813503 6:148282864-148282886 CGGAGAAATGAGTTTGGGGAGGG - Intronic
1017444596 6:154495907-154495929 CAGAGCCGTGGCAATGGGGAGGG - Intronic
1018246940 6:161832766-161832788 CAGACCGTAGAGAATGGGGAGGG - Intronic
1018288341 6:162264634-162264656 GGGAGCTCTGAGAATGGGGAGGG - Intronic
1018421265 6:163642696-163642718 GAGAGCAAGGAAAACGGGGAGGG + Intergenic
1018471131 6:164099382-164099404 CAGAGCTTTAAAAATGGGGAAGG - Intergenic
1018549666 6:164981303-164981325 CAGAGCAGAGAGAAGGGGAAAGG + Intergenic
1019397617 7:830634-830656 CAAAGCAAGGAAGATGGGGATGG - Intronic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1019834443 7:3368469-3368491 CAGAGCAATCAGTATGGAGTAGG + Intronic
1020243909 7:6416025-6416047 CAGGGCTGTGAGAATGGGGGAGG + Intronic
1022668480 7:32432730-32432752 GTGAGAAATGAGAATGGGGAGGG - Intergenic
1023155074 7:37242071-37242093 GAGAGGAAAAAGAATGGGGAAGG - Intronic
1024382568 7:48715246-48715268 GAGAGTAAAGAGAATGGGGAAGG - Intergenic
1024383360 7:48724229-48724251 CAGAGCAATAAGATTTGGGTGGG + Intergenic
1024772751 7:52743750-52743772 CAGAGCTGTGAGCATGGGGTGGG - Intergenic
1025035066 7:55588805-55588827 CAGAGTCAGGAGAATGGGGCAGG - Intergenic
1026474908 7:70726900-70726922 GAGAGGAAAGAGAATGAGGAAGG - Intronic
1028077311 7:86532996-86533018 CAGAGCACTGAGAGGGGGCATGG - Intergenic
1030131810 7:106207910-106207932 CAGAGCAAGGAGACAGGAGAAGG - Intergenic
1031655107 7:124345450-124345472 CAGAGCAATCAGACAAGGGAAGG - Intergenic
1031878845 7:127173383-127173405 CAGAGCAAAGGTCATGGGGAAGG + Intronic
1032073024 7:128821370-128821392 CAGAGTCAAGAGGATGGGGAAGG - Intronic
1033004596 7:137548004-137548026 AAGAGCAAAGAGAATGAAGAAGG + Intronic
1033426888 7:141252881-141252903 CAGGGCAAGGAGAATGGAGCTGG - Intronic
1033449148 7:141447537-141447559 CAGAGCAAGCAGAATGCGGATGG - Intronic
1033669623 7:143478585-143478607 CAGAGCATAAAGAATGAGGAAGG - Exonic
1033679675 7:143582169-143582191 CAGAGAAATGAACATGAGGAGGG - Intergenic
1033692160 7:143747274-143747296 CAGAGAAATGAACATGAGGAGGG + Intergenic
1033758824 7:144419541-144419563 CAAAGCCATCAAAATGGGGAAGG - Intergenic
1034465311 7:151224664-151224686 CAAAGCATTTAGAATAGGGATGG - Intronic
1034815518 7:154169074-154169096 CAGCGCAATCAGAAGGGGTATGG - Intronic
1034993266 7:155561282-155561304 AAGAGAAAGGGGAATGGGGATGG + Intergenic
1035237760 7:157509509-157509531 GAGAGCAATGGAGATGGGGAGGG + Intergenic
1035741359 8:1930598-1930620 CAGAGCAGAGAGAACGGGGGTGG - Intronic
1036390961 8:8324085-8324107 CAGGGCAAGCACAATGGGGAAGG + Intronic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1036649820 8:10635080-10635102 CAGAGCAATGGAACCGGGGAGGG + Intronic
1037162593 8:15791058-15791080 CAGGGTAATGGAAATGGGGATGG + Intergenic
1037826388 8:22163000-22163022 CAGAGGCCTGAGTATGGGGATGG + Intronic
1037928462 8:22863609-22863631 CAGAGCAGTGAGAAGGGGTGGGG - Intronic
1038415767 8:27394266-27394288 CAGAGAAATGATGATAGGGAAGG - Intronic
1038644694 8:29351870-29351892 AAGAGAAATGGGGATGGGGAGGG - Intergenic
1038788060 8:30640348-30640370 CAGTGCAGTGTTAATGGGGATGG - Intronic
1038954382 8:32451385-32451407 CAGGGCAATGAGAAAGGAAATGG + Intronic
1038999313 8:32962228-32962250 TAGGGGAATGAGATTGGGGATGG + Intergenic
1039244149 8:35589644-35589666 CTGAGCAAGGAGTATGGGGAAGG - Intronic
1040030843 8:42822158-42822180 CAGTGCATTGAAGATGGGGAAGG + Intergenic
1041012865 8:53560572-53560594 CAGAGCATTGAGAGGGGGCATGG + Intergenic
1042515783 8:69657418-69657440 CACAGCACTGACAATGAGGATGG - Intronic
1042599593 8:70485436-70485458 TGGAGCAATGAGAAATGGGAGGG + Intergenic
1042777929 8:72455304-72455326 CAGAGCAATCAGGAAAGGGAAGG - Intergenic
1042886249 8:73555130-73555152 TAGAGCAGTGGGAATGGGAAAGG + Intronic
1044546407 8:93465254-93465276 CAGAGGAATGACAATGGTGAAGG - Intergenic
1046974894 8:120263384-120263406 CACAGCCATGAGGATGGGAAGGG + Intronic
1049695905 8:143984164-143984186 CAGAGGCGTGAGAAAGGGGAGGG + Intronic
1050671631 9:8004364-8004386 CAGGGCAATGAGGCAGGGGAAGG - Intergenic
1051239510 9:15038568-15038590 CAGAGCAATGAGGCAGGAGAAGG + Intergenic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1052153953 9:25158245-25158267 CAAAGCATTGTGGATGGGGATGG - Intergenic
1053499563 9:38574061-38574083 CTGGGAAATAAGAATGGGGAGGG - Intronic
1054790299 9:69250593-69250615 CTGAGGAATGAGACTGGGGTGGG - Intronic
1055919646 9:81445796-81445818 CAGAGGAAAGAGTATGGGGGAGG - Intergenic
1056502463 9:87223374-87223396 CACAGCAATGAGGAAGGGCACGG + Intergenic
1056798434 9:89674965-89674987 CAGAGTGCTTAGAATGGGGAAGG + Intergenic
1057049158 9:91909142-91909164 CAGAGCAATGGAAATGGAAAAGG - Intronic
1057220244 9:93253636-93253658 CAGAGCTATGAAAATAGGGCGGG + Intronic
1057572695 9:96216432-96216454 CAGAGGAATGGGACAGGGGATGG + Intergenic
1057784354 9:98075346-98075368 AAGAGCAGTGAGAAAGGTGAAGG + Intronic
1057960926 9:99456081-99456103 CAGAGACATGAGAATTGGAAAGG + Intergenic
1058875575 9:109241911-109241933 ATGAGCCATGTGAATGGGGATGG + Intronic
1060062141 9:120470315-120470337 CAAAGCAATGTGAATGGGGGAGG + Intronic
1060839516 9:126782661-126782683 AAAAGGAGTGAGAATGGGGAGGG + Intergenic
1062093099 9:134688855-134688877 CAGAGAACTGTGGATGGGGAGGG + Intronic
1203707283 Un_KI270742v1:63976-63998 CTGGGAAATAAGAATGGGGAGGG + Intergenic
1185724420 X:2407964-2407986 CAGAGCATTGAGAATCTAGATGG + Intronic
1186026494 X:5319377-5319399 CCAAGCAAGGAGAATGGGGCAGG + Intergenic
1186063247 X:5733451-5733473 CAGTGCACTGAGAAAGGAGATGG - Intergenic
1187280244 X:17853030-17853052 CGGAGAAATGACAGTGGGGAGGG + Intronic
1188107935 X:26165283-26165305 CAGGGCAAGGACAATGAGGAAGG + Intergenic
1188697084 X:33207107-33207129 CAGACAAATGAGAATGAGGAAGG - Intronic
1188962906 X:36514750-36514772 AAGAGCAATGAAAAAGGGGTGGG + Intergenic
1190158103 X:48009832-48009854 CAGATCACTCAGAGTGGGGAAGG + Intronic
1190173874 X:48132716-48132738 CAGATCACTCAGAGTGGGGAAGG + Intergenic
1190411722 X:50143214-50143236 CAGAGCAATGGCCATGGGCATGG - Intergenic
1190458670 X:50649034-50649056 CAGAGCAATGGCAGTGGGGATGG + Intronic
1191055445 X:56235067-56235089 TAGAACAATGAGAGTGGTGATGG - Intronic
1191996415 X:67100533-67100555 CAGAGCAATAGGTATGGGGAAGG - Intergenic
1192192842 X:69003436-69003458 CAGACCAATCAGAATGGACAAGG - Intergenic
1194995648 X:100588935-100588957 CAGAGCAATGAGGAGTGGTAGGG + Intronic
1195456037 X:105070813-105070835 CAGACCATTGAAGATGGGGAAGG - Intronic
1196055976 X:111355698-111355720 CAGAGCCAAGAGAAGGGGAAAGG + Intronic
1196496509 X:116329774-116329796 CACAGCAATGAGAAGGAGCATGG + Intergenic
1197249523 X:124200439-124200461 AAGGGAAATGGGAATGGGGAAGG - Intronic
1197597662 X:128485887-128485909 CAGAGGAATTAAGATGGGGAAGG - Intergenic
1197611829 X:128647956-128647978 CAGAGCAATCAGAAAAGAGAAGG + Intergenic
1198069585 X:133134846-133134868 AGGAGAAAAGAGAATGGGGAGGG + Intergenic
1200686456 Y:6263948-6263970 CAGATCAAGGAGAAAGAGGATGG + Intergenic
1201041665 Y:9839717-9839739 CAGGGCAATTAGAAAGGAGAAGG - Intergenic
1201595196 Y:15660488-15660510 CAAAGCAAGAAGAAGGGGGAAGG - Intergenic