ID: 1012629135 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:101441892-101441914 |
| Sequence | CAGAACATAAGAAAGTAGTC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1012629133_1012629135 | 9 | Left | 1012629133 | 6:101441860-101441882 | CCACTTTATTTTATTTTACTTTG | 0: 1 1: 4 2: 113 3: 723 4: 3737 |
||
| Right | 1012629135 | 6:101441892-101441914 | CAGAACATAAGAAAGTAGTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1012629135 | Original CRISPR | CAGAACATAAGAAAGTAGTC TGG | Intronic | ||
| No off target data available for this crispr | |||||