ID: 1012629135

View in Genome Browser
Species Human (GRCh38)
Location 6:101441892-101441914
Sequence CAGAACATAAGAAAGTAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012629133_1012629135 9 Left 1012629133 6:101441860-101441882 CCACTTTATTTTATTTTACTTTG 0: 1
1: 4
2: 113
3: 723
4: 3737
Right 1012629135 6:101441892-101441914 CAGAACATAAGAAAGTAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012629135 Original CRISPR CAGAACATAAGAAAGTAGTC TGG Intronic
No off target data available for this crispr