ID: 1012630828

View in Genome Browser
Species Human (GRCh38)
Location 6:101464896-101464918
Sequence CCATATACTTAGTCTCTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 134}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012630828_1012630833 26 Left 1012630828 6:101464896-101464918 CCTGGCAGAGACTAAGTATATGG 0: 1
1: 0
2: 0
3: 6
4: 134
Right 1012630833 6:101464945-101464967 TCTAAGTCAATCTTGATAACAGG 0: 1
1: 0
2: 0
3: 10
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012630828 Original CRISPR CCATATACTTAGTCTCTGCC AGG (reversed) Intronic
902073372 1:13762106-13762128 CCATTTATTGAGTCTGTGCCAGG + Intronic
903636878 1:24825423-24825445 CCATTTTCTTTGTTTCTGCCTGG - Intronic
905823348 1:41011162-41011184 CCACCTACTTAGGCTATGCCAGG - Intronic
909115103 1:71523611-71523633 CCAGATGCTTGGACTCTGCCTGG - Intronic
910878087 1:91896482-91896504 CCACATACTTGCTCCCTGCCTGG - Intronic
1062889071 10:1043517-1043539 CCACATGCATAGTCTCTGCATGG + Intronic
1066592007 10:37005891-37005913 CCATCTCCTGAGTCTCTGCAAGG + Intergenic
1068763925 10:60742332-60742354 CCATGTACTTAGTATATGCTGGG + Intergenic
1069870514 10:71530074-71530096 CCCCAGACTCAGTCTCTGCCTGG + Intronic
1070490540 10:76971702-76971724 CCAGCCACATAGTCTCTGCCTGG - Intronic
1070794221 10:79207590-79207612 CCATCGACTCAGACTCTGCCTGG + Intronic
1071514477 10:86288091-86288113 CCATAGACTCAGCTTCTGCCGGG - Intronic
1073355404 10:102849907-102849929 CCATCTACTTAGTGTCTCACAGG + Intergenic
1073984244 10:109189877-109189899 CGGTGTACTTAGTCTATGCCAGG + Intergenic
1074325261 10:112445046-112445068 TAATATACTTAGTCTCTGTGAGG + Intronic
1077786598 11:5390719-5390741 GCATTTACCTGGTCTCTGCCAGG - Intronic
1078740819 11:14064747-14064769 CCATTTACCTATGCTCTGCCAGG - Intronic
1085204326 11:74721455-74721477 CCACATTCTCAGCCTCTGCCAGG - Intronic
1085896226 11:80642647-80642669 CCATCTCCTGAGTCTCTGCAAGG - Intergenic
1086223080 11:84473449-84473471 GCATACACTTAGTCTCTGTTAGG - Intronic
1089653067 11:119927486-119927508 CGGTAAACTTAGGCTCTGCCAGG - Intergenic
1091456315 12:610617-610639 CCACATATTAAGTCCCTGCCTGG - Intronic
1092442597 12:8520331-8520353 CAATATACTTACACTCTGCGTGG - Exonic
1094801462 12:34041098-34041120 CCATCTACATAGTCTCTCCCTGG + Intergenic
1095114593 12:38337092-38337114 CCATCTACATAGTCTCTCCCTGG + Intergenic
1095235669 12:39792552-39792574 CTAGATACTAAGCCTCTGCCAGG + Intronic
1095748509 12:45686211-45686233 CCTAAGACTGAGTCTCTGCCTGG + Intergenic
1106025295 13:25950186-25950208 CGATATACTGTTTCTCTGCCTGG + Intronic
1107900379 13:45006853-45006875 CTATATACTTACTCTGTGCCAGG - Intronic
1108044101 13:46366593-46366615 TCATATACCTATTCTGTGCCAGG + Intronic
1109913089 13:68942664-68942686 CCATATATTTACTCTGTGCTTGG - Intergenic
1112765320 13:102735713-102735735 GCATATACTGAGTCACTGCATGG - Exonic
1114588041 14:23832781-23832803 TCAGATACTCAGTCTCTACCAGG - Intergenic
1114694706 14:24615607-24615629 CTATATACATAATCTCTCCCTGG - Intergenic
1114896827 14:27001183-27001205 CCATATTCTTTGCCTATGCCTGG + Intergenic
1117598538 14:57349184-57349206 CCATATTCTTACTGTCTGTCAGG + Intergenic
1120221411 14:81738194-81738216 CCAGATACAGAGTCTCTGACAGG - Intergenic
1122278176 14:100605869-100605891 CCATTTACTTGGTCTCTGTTTGG + Intergenic
1125743341 15:41982735-41982757 CTATAGACTTAGGCTTTGCCTGG + Exonic
1128864112 15:71100307-71100329 CCATAGACTCACTCTCTTCCTGG + Intronic
1131249183 15:90819582-90819604 CCATCTACTCAGTCCCTGCCAGG + Intergenic
1134196338 16:12162084-12162106 CCATGTACTTACTTCCTGCCGGG + Intronic
1136392788 16:29975793-29975815 CCATATGCTGAGTGTCTGCATGG + Intronic
1137533934 16:49302998-49303020 GCACATGCTAAGTCTCTGCCTGG + Intergenic
1140688679 16:77459647-77459669 CTAGATACTTATTCTGTGCCTGG - Intergenic
1142760282 17:2037968-2037990 GCAGGTACTTAGTCTATGCCTGG + Intronic
1143655879 17:8293391-8293413 CCAAATGCTTACTGTCTGCCAGG + Intronic
1144720283 17:17464375-17464397 CCAGGTGCTTAGTCTCTACCTGG + Intergenic
1146374386 17:32284529-32284551 CCAGACACTGAGCCTCTGCCAGG + Intronic
1147494778 17:40905303-40905325 CCAGTTACTCAGACTCTGCCTGG - Intergenic
1148164617 17:45474632-45474654 CAAGATACTTAGTCTCTACAAGG - Intronic
1150395837 17:64821295-64821317 CAAGATACTTAGTCTCTACAAGG - Intergenic
1155254697 18:23984491-23984513 CCATTTACTGAATCTCTGCTAGG - Intergenic
1157116930 18:44870780-44870802 CAATAAACTCAGTCTCTACCGGG - Intronic
1160058856 18:75511066-75511088 CTATATACTTAGTTTTTTCCTGG - Intergenic
1162547168 19:11337998-11338020 ACAAATGCTTACTCTCTGCCGGG + Intronic
1168683875 19:58336245-58336267 CCATTTATTTAATCTGTGCCAGG - Intronic
925602710 2:5625559-5625581 CCATGTACTCAGTATCTGCTGGG + Intergenic
926114645 2:10204742-10204764 GCAGATACTTAGTCTGTGGCTGG + Intronic
927263092 2:21114431-21114453 CTATGTCCTTTGTCTCTGCCTGG + Intergenic
927276167 2:21264344-21264366 CCATATGCTAAGCCTGTGCCAGG + Intergenic
929445828 2:42000391-42000413 CCAAATGCTTACTCTGTGCCAGG + Intergenic
929713015 2:44283393-44283415 CAAAATACTTACTCTGTGCCAGG + Intronic
932525571 2:72463522-72463544 CCTAGTAGTTAGTCTCTGCCTGG - Intronic
934037175 2:88097921-88097943 CCAACTGCTTTGTCTCTGCCTGG - Intronic
935247436 2:101231325-101231347 CCATATTCTTATGCACTGCCCGG + Intronic
938560954 2:132471447-132471469 CCACATACTTTGACTCTACCAGG - Intronic
939300069 2:140325160-140325182 CCTCATACTTTTTCTCTGCCTGG - Intronic
940861157 2:158771775-158771797 CCCTAAACCTGGTCTCTGCCTGG + Intergenic
945082741 2:206102494-206102516 CTATATACTTACTTTCTGTCTGG + Intergenic
945744096 2:213699505-213699527 CCATATTATTAGTATTTGCCAGG - Intronic
1170453199 20:16507361-16507383 GCATATACTTAGACCCTGACAGG + Intronic
1172828236 20:37808586-37808608 CCAGATACTTTTCCTCTGCCTGG + Intronic
1172950096 20:38717700-38717722 CCAAATGCTTATTCTCTGCTAGG - Intergenic
1179294911 21:40053164-40053186 CCAATTACTCAGTCTCTGGCAGG + Intronic
1182661443 22:31928028-31928050 CCATAGCCCTAGTCTCAGCCAGG + Intergenic
1182877853 22:33707936-33707958 CCATATCCTGGGTCTCTGCTTGG - Intronic
1182943066 22:34296758-34296780 ACATATACTTAGTTGCTGCTAGG - Intergenic
951626558 3:24670959-24670981 CCATATAGTGAATTTCTGCCTGG - Intergenic
954972898 3:54666002-54666024 CCAAATACTCATTCTCAGCCTGG - Intronic
955205296 3:56890289-56890311 CCATACACTTAGAACCTGCCTGG - Intronic
956892062 3:73623169-73623191 GCATTTATTTACTCTCTGCCAGG + Intronic
962194900 3:133353052-133353074 ATATATATTTGGTCTCTGCCTGG - Intronic
962868931 3:139471373-139471395 CCATCTAAGTGGTCTCTGCCAGG - Intronic
963094947 3:141526206-141526228 GCATTTACTGAGTCTCTACCAGG - Intronic
964956451 3:162364064-162364086 ACATATACTTAGACTCTACATGG + Intergenic
969134150 4:5016563-5016585 CCACATAGATAGACTCTGCCAGG - Intronic
969334848 4:6501737-6501759 CCAGATACTCACTCTCTACCTGG + Intronic
975376341 4:73650757-73650779 GCACATACTTACTCTGTGCCAGG - Intergenic
977231404 4:94454518-94454540 GCAAATGCTTACTCTCTGCCTGG + Intronic
978402929 4:108349889-108349911 CCATATCCTTAGTCCCTCGCTGG + Intergenic
980831977 4:138141138-138141160 CCATATACCTATTCTTTACCAGG + Intergenic
985216125 4:187656294-187656316 GCATATACTTAGACTTTGCTAGG - Intergenic
990347574 5:54884614-54884636 CTATATCCTCAGTGTCTGCCTGG + Intergenic
996640331 5:125743982-125744004 CCCTGTAATCAGTCTCTGCCTGG - Intergenic
998013661 5:138715326-138715348 CCAAATACCTATTCTCAGCCGGG - Intronic
998501969 5:142640934-142640956 CCATATACTTAGTAGATGCTCGG + Intronic
999240477 5:150124649-150124671 CCACACACTTAGCCTCTCCCAGG - Intronic
999426077 5:151488648-151488670 CCAGTTACTTAATCTATGCCTGG - Exonic
999942503 5:156559296-156559318 CTCTAGGCTTAGTCTCTGCCTGG + Intronic
1004946847 6:20624454-20624476 CTATACACTTATTATCTGCCTGG - Intronic
1007006168 6:38365137-38365159 TTAAATACTTAGTCTATGCCAGG + Intronic
1007055947 6:38884950-38884972 CCATCTACTTTGGCTCTACCAGG + Intronic
1007607878 6:43129551-43129573 CCAGATACTAAGTGCCTGCCTGG - Intronic
1009437343 6:63633736-63633758 CCATGGTCTTAATCTCTGCCAGG + Intergenic
1012033663 6:94104297-94104319 CCATATCCTTACCCTCTTCCTGG + Intergenic
1012424149 6:99095866-99095888 CCATAGACTCACTCTCTGCCAGG - Intergenic
1012630828 6:101464896-101464918 CCATATACTTAGTCTCTGCCAGG - Intronic
1012791337 6:103701236-103701258 CCACATGTTTAGTCTCTGCATGG + Intergenic
1013234656 6:108186813-108186835 CATTATACTTAGTCTCTCTCAGG - Intronic
1013595695 6:111658635-111658657 GCAAATACTTATTCACTGCCAGG + Intergenic
1015080046 6:129212548-129212570 TCATAAACCTAGTGTCTGCCTGG - Intronic
1016384733 6:143519380-143519402 CCATGTAGTTGGCCTCTGCCTGG - Intergenic
1018456727 6:163960258-163960280 CCAGATTCTTTGTCTCTGCAAGG + Intergenic
1019295471 7:271883-271905 CCACATCCTCAGCCTCTGCCTGG - Intergenic
1021700818 7:23317895-23317917 CTATATGCTTATTCTGTGCCGGG + Intronic
1021958986 7:25853544-25853566 CCAGATCCTTAGTGTCTGCAGGG - Intergenic
1024234359 7:47386596-47386618 CCATATACCTAGAGCCTGCCTGG - Intronic
1024489155 7:49957685-49957707 CCCTATGGTAAGTCTCTGCCTGG - Intronic
1028166381 7:87542272-87542294 CCAAATTCTTACTCTATGCCAGG + Intronic
1031322020 7:120342317-120342339 CCAAATGCTTATTCTATGCCAGG - Intronic
1033907690 7:146225830-146225852 TCATATAATTAGTCTCTTTCTGG + Intronic
1036160988 8:6388374-6388396 CCAGATATTCAGTCTCTGCAGGG + Intergenic
1042211068 8:66381143-66381165 GCATATGCTTACTCTGTGCCTGG + Intergenic
1043171102 8:76967685-76967707 CCATGGACTTGGTCTCTGCAGGG - Intergenic
1043627682 8:82283554-82283576 CCGTATACTGAGTTTCTGCAAGG + Intergenic
1043885175 8:85590515-85590537 CCAAATACTTACTATGTGCCAGG + Intergenic
1045903374 8:107312297-107312319 CCATATACTTTTTTTCAGCCTGG + Intronic
1048291931 8:133187774-133187796 CCAGACACTTAGTGTTTGCCCGG + Intergenic
1052232326 9:26168561-26168583 TCATATGCTTTTTCTCTGCCAGG + Intergenic
1056334104 9:85549156-85549178 CCACATACTTATTTTCTTCCTGG + Intronic
1061302215 9:129711909-129711931 CCACATCCTTAGCCACTGCCTGG - Intronic
1186215021 X:7290405-7290427 CTATATACTTACTGTCTGCCAGG + Intronic
1186461550 X:9752361-9752383 TTATAAACATAGTCTCTGCCAGG - Intronic
1188835775 X:34952640-34952662 CCATATGCTTATTCACTGCATGG - Intergenic
1190710553 X:53065543-53065565 ACAAAACCTTAGTCTCTGCCTGG - Intronic
1193847115 X:86486401-86486423 CCACTTACTTAGTTTCTGTCTGG + Intronic
1200214504 X:154361658-154361680 CCAACTACTTACTCTCTCCCAGG + Exonic
1201320877 Y:12697141-12697163 CCATAAACTTTATCTGTGCCTGG - Intergenic
1202176680 Y:22104850-22104872 CCATATAGTTGCTCTCTCCCAGG - Intergenic
1202214681 Y:22481534-22481556 CCATATAGTTGCTCTCTCCCAGG + Intergenic