ID: 1012635766

View in Genome Browser
Species Human (GRCh38)
Location 6:101538898-101538920
Sequence ACTACCACATAAAATTTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 315}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012635766 Original CRISPR ACTACCACATAAAATTTGGT TGG (reversed) Intronic
905540084 1:38753772-38753794 ATTTCAACATAAAATTTGGGAGG - Intergenic
907806676 1:57827504-57827526 TCTACCTCATCAAATTTTGTGGG + Intronic
908559063 1:65286623-65286645 ACTACAACAGAAAAGATGGTAGG + Intronic
909304368 1:74054120-74054142 ACTACCAAATATACTTTAGTAGG + Intronic
909400003 1:75217425-75217447 ACAAACACATAAACTTTGCTTGG - Intronic
909469803 1:76014175-76014197 ACTACAAGATGAAATTTGGGTGG + Intergenic
911160762 1:94680628-94680650 TCTAACACATAAATTTTGGAGGG + Intergenic
911571982 1:99528401-99528423 ATTTCAACATGAAATTTGGTGGG + Intergenic
917813080 1:178679226-178679248 ACTTCAACATAAGATTTGGAGGG + Intergenic
917826396 1:178825833-178825855 ACCATCACATAAAATTCTGTTGG + Intronic
919129505 1:193435725-193435747 AATACAACATGAAATTTGGATGG - Intergenic
920525072 1:206660266-206660288 AGTACCACATATATTGTGGTTGG + Intronic
920688685 1:208129379-208129401 GCTACAACATAGAACTTGGTAGG - Intronic
921169526 1:212534096-212534118 ACTCTCTCATGAAATTTGGTGGG - Intergenic
921758502 1:218885194-218885216 AATTCCACATGAAATTTGGGTGG + Intergenic
921922857 1:220688122-220688144 AATTCAACATGAAATTTGGTGGG + Intergenic
922005161 1:221522897-221522919 ACTACCACATATTCTTTGTTTGG + Intergenic
922747371 1:228052016-228052038 ACTTCAACATGAAATTTGGAGGG + Intronic
924792261 1:247262816-247262838 AATTCCACATGAAATTTGGGTGG - Intergenic
924868071 1:248007663-248007685 ACTACAGCATAACATTTGGATGG - Intronic
1063836061 10:10014095-10014117 TCTATCACATAAAATTATGTAGG + Intergenic
1064721101 10:18229413-18229435 AATCCCACATTAAATTTGGCTGG - Intronic
1065060589 10:21896780-21896802 GCTTCCACATAAATTTTGGAAGG - Intronic
1065721709 10:28634127-28634149 ACAACCACCTAATATATGGTAGG - Intergenic
1066683464 10:37958364-37958386 GAAACCACATATAATTTGGTAGG + Intronic
1067012390 10:42726768-42726790 AATTCCACATGAGATTTGGTGGG - Intergenic
1067311202 10:45115124-45115146 AATTCCACATGAGATTTGGTGGG + Intergenic
1067488770 10:46678091-46678113 AATTCAACATAAGATTTGGTGGG + Intergenic
1067605899 10:47662285-47662307 AATTCAACATAAGATTTGGTGGG - Intergenic
1067798823 10:49342395-49342417 AATTCGACATAAGATTTGGTGGG + Intergenic
1070457273 10:76629856-76629878 CCTCCCACACAATATTTGGTAGG - Intergenic
1071389844 10:85162043-85162065 ACTAACTCCTAAAATTTGTTAGG + Intergenic
1072197125 10:93125775-93125797 AATACAACATGAGATTTGGTGGG + Intergenic
1072273009 10:93795540-93795562 GCTACAACATAAATTTTGGAGGG + Intronic
1072919579 10:99564942-99564964 GAAACCACATAAAATTTTGTGGG + Intergenic
1079275897 11:19037511-19037533 ATTCCCACATCAAATTTGGTAGG + Intergenic
1079983360 11:27175174-27175196 ACTTCCTCCCAAAATTTGGTTGG - Intergenic
1080281681 11:30564385-30564407 ACGTCCCCAGAAAATTTGGTAGG + Intronic
1080904979 11:36534882-36534904 ACTACCACATTAGAACTGGTAGG - Intronic
1081162281 11:39764007-39764029 ACTATCACTTAAAATGAGGTTGG - Intergenic
1081286024 11:41271108-41271130 ACTAGGACATATAATTTGGGGGG + Intronic
1081510888 11:43772101-43772123 ACCAACAGATAAAATTTTGTAGG - Intronic
1082018153 11:47508285-47508307 TGTTCCACATAAAATTTGGAGGG - Intronic
1083791749 11:64990188-64990210 TCTACCACAGGGAATTTGGTGGG - Intronic
1083844905 11:65325923-65325945 ACAAAAACATAAAGTTTGGTGGG - Intergenic
1084753072 11:71216795-71216817 TCTAGCACATACAATTTTGTAGG + Intronic
1085954613 11:81376727-81376749 ACTACCATAAATATTTTGGTTGG - Intergenic
1086700746 11:89898114-89898136 ACTTCCACAGAAATTTTGGAAGG + Intergenic
1086705423 11:89946413-89946435 ACTTCCACAGAAATTTTGGAAGG - Intergenic
1087565113 11:99845806-99845828 AATAACACATAAAAAGTGGTGGG - Intronic
1088369368 11:109072467-109072489 ATTTCAACATGAAATTTGGTGGG + Intergenic
1090517139 11:127440918-127440940 ACTTGAACATAAAATTTGGCAGG - Intergenic
1091482901 12:853231-853253 AATACAACCTTAAATTTGGTAGG - Intronic
1092283657 12:7116032-7116054 AATTCCACATGAGATTTGGTTGG + Intergenic
1095054967 12:37587500-37587522 ACTACCATACAAAAATTAGTTGG - Intergenic
1095866880 12:46982529-46982551 ACTACCACATCAAATTTAAACGG + Intergenic
1097365902 12:58712148-58712170 TATACCACATAAACTTTTGTGGG - Intronic
1098697784 12:73581329-73581351 AGGACAACATGAAATTTGGTTGG + Intergenic
1099747518 12:86724482-86724504 AATACCCCATATAATATGGTAGG - Intronic
1101049083 12:100842280-100842302 ACAACCACATAAAAGATGGAAGG - Intronic
1102769711 12:115464776-115464798 ACTGCCAAAGAAAAGTTGGTTGG + Intergenic
1104119967 12:125789657-125789679 AATTCAAGATAAAATTTGGTTGG - Intergenic
1105609589 13:21956330-21956352 GCTACAAGATAAGATTTGGTGGG + Intergenic
1106811478 13:33362409-33362431 ATTTCCACATAAGATTTGGAGGG + Intergenic
1106824039 13:33499923-33499945 ACAACAACAAAAAATTTGCTGGG - Intergenic
1107387255 13:39925711-39925733 ACTACTCCATAAAATTGGGAGGG - Intergenic
1109079124 13:57875520-57875542 ATTACAGCATGAAATTTGGTGGG + Intergenic
1109507710 13:63328436-63328458 AATTCAACATAAAATTTGGGTGG - Intergenic
1112874958 13:104025937-104025959 ACTACCAGATGAGATTTGGGTGG - Intergenic
1112976844 13:105330342-105330364 AATTCCACATAAGATTTGGGTGG + Intergenic
1114918420 14:27296066-27296088 ATTTCAACATGAAATTTGGTGGG + Intergenic
1116016283 14:39411254-39411276 ACTACTACAAAAAATTAGTTGGG - Intronic
1116422707 14:44751726-44751748 AATTCAACATAAGATTTGGTGGG - Intergenic
1116744750 14:48803618-48803640 CCTAACATATAAAATATGGTTGG - Intergenic
1117273738 14:54171129-54171151 ACTACCACATAAAATCCAGAGGG - Intergenic
1118495893 14:66307876-66307898 GCTTCAACATACAATTTGGTAGG + Intergenic
1120075996 14:80159073-80159095 ACTATCACATGGAATTTGGAAGG + Intergenic
1121896122 14:97649489-97649511 ACTACCAAATAAAAGTAGGCAGG + Intergenic
1122518760 14:102327572-102327594 ACTTCAACATGAGATTTGGTGGG + Intronic
1124203605 15:27698906-27698928 ATTTCAACATAAGATTTGGTGGG - Intergenic
1124477734 15:30049511-30049533 AATACCAAAAAAAATTTGCTGGG - Intergenic
1124498309 15:30202215-30202237 ATTTCAACATAAAATTTAGTGGG - Intergenic
1124745274 15:32336459-32336481 ATTTCAACATAAAATTTAGTGGG + Intergenic
1125002405 15:34785269-34785291 AATTCAACATAAGATTTGGTGGG - Intergenic
1125105310 15:35963970-35963992 TCTAACATATAAAATTTAGTAGG + Intergenic
1126301153 15:47197614-47197636 ACTACCACAACAAAATTAGTGGG + Intronic
1126336800 15:47593984-47594006 AATTCCACATGAAATTTGGGTGG + Intronic
1127004790 15:54556476-54556498 ACTGCCACATTAAAGTTGGGAGG + Intronic
1127427302 15:58868872-58868894 ATTTTCACATAAGATTTGGTGGG - Intronic
1129903085 15:79166589-79166611 ACTACCACCTACAATTTCCTGGG + Intergenic
1130350092 15:83083875-83083897 ACTACTAAATAAAATATTGTGGG - Intergenic
1131699731 15:94921356-94921378 AATTCCACATGAAATTTGGGTGG + Intergenic
1135241365 16:20809356-20809378 ACAACTACAGAAAATTTGGATGG - Intronic
1135729454 16:24882178-24882200 CCTACCACGTAGAACTTGGTGGG + Intronic
1135738488 16:24953374-24953396 ACTTCCACATGAGATTTGGGTGG - Intronic
1135795021 16:25433492-25433514 ACTAGCACATAGCATATGGTAGG - Intergenic
1136856124 16:33659340-33659362 AATTCCACATAAGATTTGGGTGG + Intergenic
1137836434 16:51596994-51597016 AATTCAACATGAAATTTGGTGGG - Intergenic
1138769529 16:59647593-59647615 CCTACCACATAGGATTTTGTAGG + Intergenic
1138964434 16:62067146-62067168 ATTGCCACATAAGATTTGGATGG - Intergenic
1139823636 16:69740091-69740113 TCTACCAAATAAAATTTGATGGG + Intergenic
1140623487 16:76764473-76764495 ATTTCCACATAAGATTTGGAGGG - Intergenic
1203117710 16_KI270728v1_random:1507819-1507841 AATTCCACATAAGATTTGGGTGG + Intergenic
1144216241 17:13058015-13058037 AATTCCACATGAGATTTGGTTGG + Intergenic
1149195746 17:54117966-54117988 CCTGCTACAGAAAATTTGGTAGG + Intergenic
1149310226 17:55386147-55386169 AATTCCACATGAGATTTGGTGGG - Intergenic
1149703651 17:58676073-58676095 ACTAAAACATAAAAATTAGTCGG + Intronic
1149809911 17:59658457-59658479 GCTGGCACATAAAATTTGGGAGG - Intronic
1151986157 17:77545207-77545229 ACTTCCAAATGAAATTTGATTGG + Intergenic
1153486652 18:5605316-5605338 CCTAACACTTGAAATTTGGTAGG - Intronic
1155355452 18:24948439-24948461 ATTACAACATAAAATTAGGAGGG - Intergenic
1156289000 18:35728957-35728979 ACTACAAGATGAAATTTGGGTGG - Intergenic
1156678884 18:39565569-39565591 ATTACCATAGAAAACTTGGTGGG + Intergenic
1156736049 18:40261632-40261654 ACTTCAACATGAAATTTGGAGGG - Intergenic
1161742226 19:6028916-6028938 AATACCAAAAAAAATTAGGTGGG + Intronic
1162255812 19:9488773-9488795 AGTTCCACATGAGATTTGGTGGG - Intronic
1163933709 19:20422994-20423016 ACTACCACACAAAATTAGCCGGG + Intergenic
1165334878 19:35162678-35162700 ACCATCACATGGAATTTGGTGGG + Intronic
925036068 2:686788-686810 AATTCCACATGAAATTTGGATGG - Intergenic
925186899 2:1853874-1853896 ACTACCACAAAAACTTTTATAGG - Intronic
926545822 2:14238649-14238671 AATTCCACATAAGATTTGGGTGG - Intergenic
926713885 2:15908538-15908560 ACTACAAGATAAGATTTGGGTGG - Intergenic
927270190 2:21199148-21199170 ATTACCACATTTAATTTAGTAGG - Intergenic
928218315 2:29380859-29380881 AATTCAACATGAAATTTGGTGGG + Intronic
928556371 2:32430170-32430192 ACTAAAATATAAAATCTGGTAGG - Intronic
930207630 2:48603807-48603829 AATGCAACATAAAATTTGGAGGG + Intronic
931752273 2:65340424-65340446 ATTCTCACATAACATTTGGTGGG - Intronic
932638108 2:73411041-73411063 ACTGCAACATATAATTTGGGAGG - Intronic
935646533 2:105340466-105340488 ACTACAATAGTAAATTTGGTGGG + Intronic
935988128 2:108694243-108694265 ACTACCAAAAACAATTTGATGGG - Intergenic
936168678 2:110148105-110148127 AATTCAACATGAAATTTGGTGGG - Intronic
936518930 2:113199608-113199630 ACTACCTATTAATATTTGGTAGG - Intronic
937897642 2:126990624-126990646 ACTACCTTATAAAGTTTTGTAGG + Intergenic
938644431 2:133316539-133316561 ACTAACACATAAACCTTGCTTGG + Intronic
938661170 2:133488665-133488687 TCTACCAAATTAAATTTGGGAGG + Intronic
939101836 2:137903877-137903899 TCTACCCAATAGAATTTGGTAGG + Intergenic
940659249 2:156526013-156526035 ACTACCACCTACAAAATGGTAGG - Intronic
941073503 2:160981546-160981568 AATTCAACATAAGATTTGGTGGG - Intergenic
941635854 2:167934300-167934322 ACTCCCACATATTTTTTGGTGGG - Intergenic
941663967 2:168225228-168225250 AATACATCATAAAATTTGGGAGG + Intronic
941663972 2:168225304-168225326 AATACATCATAAAATTTGGGAGG + Intronic
942673782 2:178405316-178405338 ACTAAAACACAAAATTAGGTGGG - Intergenic
942783411 2:179672546-179672568 ATTTCAACATAAAATTTGGGAGG - Intronic
943893356 2:193320577-193320599 ATTTCAACATAAAATTTGGGTGG - Intergenic
944765966 2:202864566-202864588 ACTACTACATTAGATTTGTTAGG - Intronic
944940029 2:204614591-204614613 AATTCAACATAAAATTTGGGTGG - Intronic
945236799 2:207638751-207638773 ACTACCACATGCAAGATGGTTGG + Intergenic
945580021 2:211581710-211581732 GCCACTACATGAAATTTGGTGGG - Intronic
945727180 2:213485715-213485737 ACTTCCACTTAAAAATTGTTTGG + Intronic
946356823 2:219191577-219191599 ACTACCACACAAAATTTACTTGG + Intergenic
1172710794 20:36921682-36921704 ACAACCACAAAAAATTAGCTGGG - Intronic
1172786257 20:37470755-37470777 ACTTCAACATAAGATTAGGTGGG - Intergenic
1172981095 20:38942339-38942361 ACTCACACATAAATTTTTGTGGG - Intronic
1173270639 20:41531647-41531669 TCTACCACAGAAACTTGGGTGGG - Intronic
1173444914 20:43108997-43109019 ACTACCCCATAATAATTGGATGG + Intronic
1174229532 20:49033619-49033641 ACTGCCACCTAAAATATGCTGGG + Exonic
1174951342 20:55044643-55044665 AATGCAACATTAAATTTGGTGGG - Intergenic
1176453705 21:6888559-6888581 TCTACCCAATAGAATTTGGTAGG + Intergenic
1176831880 21:13753607-13753629 TCTACCCAATAGAATTTGGTAGG + Intergenic
1176847066 21:13884861-13884883 AATTCCACATAAGTTTTGGTAGG + Intergenic
1176934698 21:14853191-14853213 ACTTCAACATGAAATTTGGAGGG - Intergenic
1177037936 21:16068271-16068293 ACTAACACATAGAATGTGTTTGG - Intergenic
1177489400 21:21803092-21803114 AATTCAACATGAAATTTGGTTGG - Intergenic
1177500269 21:21945541-21945563 ACTACTACAGAAAATATGATGGG + Intergenic
1178564494 21:33670500-33670522 ACAACAACATAAAATGTAGTCGG + Intronic
1181543187 22:23584977-23584999 ACCACCACATAAAAATTTGTAGG - Intergenic
949096481 3:92601-92623 AATTCCACATGAGATTTGGTGGG - Intergenic
949155678 3:825047-825069 AATTCCACATAAGATTTGGGTGG - Intergenic
950036743 3:9891226-9891248 CCTACCACGTAATATATGGTAGG + Intronic
950281295 3:11710218-11710240 ATTTCCACATAACATTTGGAGGG + Intronic
950588529 3:13916387-13916409 ATCAACATATAAAATTTGGTGGG + Intergenic
951422036 3:22497976-22497998 TCTACCTCATAAAATTTTATGGG - Intergenic
951952869 3:28220567-28220589 AATTCCACATGAGATTTGGTGGG + Intergenic
954123390 3:48514100-48514122 ACTTCAACATATAAATTGGTGGG + Intergenic
955471773 3:59294158-59294180 ACTACAAGATGAAATTTGGGTGG + Intergenic
956221209 3:66905625-66905647 ACTACAATAAAAGATTTGGTAGG + Intergenic
957868003 3:86049880-86049902 AATCCAACATGAAATTTGGTGGG + Intronic
959422237 3:106143282-106143304 ATTTCAACATAAGATTTGGTGGG - Intergenic
959748119 3:109801344-109801366 ACTGCCACATAAAAGTTGACAGG + Intergenic
960099437 3:113724714-113724736 ACTACAAGATGAAATTTGGATGG - Intronic
961073200 3:123956644-123956666 TCTACCCCAGAAAATTAGGTAGG - Intronic
962324503 3:134422282-134422304 ATTACAACATGAGATTTGGTGGG - Intergenic
963803180 3:149697575-149697597 ATTACAACATAAGATTTGGAAGG + Intronic
964127617 3:153252160-153252182 ATTTCAACATAAGATTTGGTGGG + Intergenic
964193660 3:154036074-154036096 TCTAACACATAAATTTTGGAGGG - Intergenic
964321708 3:155505180-155505202 ACGAACACATAAACTTTGCTTGG - Intronic
965048574 3:163612800-163612822 CCTACCTCTTAAAATTTTGTAGG - Intergenic
966097228 3:176218668-176218690 ACTGCCACATTAAATTTCTTTGG - Intergenic
966503902 3:180678046-180678068 ACTAAAACCTAAAATTTGGATGG + Intronic
967210745 3:187166357-187166379 GTTACCACATAAAATTTGTATGG + Intronic
970571105 4:17383918-17383940 ACTTCAACATGAATTTTGGTGGG - Intergenic
972007644 4:34131291-34131313 ATTTCAACATAAAATTTGGACGG - Intergenic
972039577 4:34575550-34575572 ACAAACACATAAAATATGGCTGG - Intergenic
972161888 4:36237381-36237403 ATTTCCACATGAAATTTGGAGGG - Intronic
974476121 4:62382625-62382647 GCTACAAGATAATATTTGGTTGG + Intergenic
976980668 4:91222705-91222727 ATTATCACATACAATTTTGTTGG - Intronic
977117752 4:93053055-93053077 ACTACCTATAAAAATTTGGTAGG - Intronic
978799695 4:112743434-112743456 ACTAACACATGTAATTAGGTTGG + Intergenic
979143901 4:117216223-117216245 AATCCCACACAAAATTTGGGTGG - Intergenic
979465214 4:121029409-121029431 ACTACCATAAAAACTTTGTTTGG - Intergenic
979784219 4:124695110-124695132 ACTGCCAGATAAAATGTAGTAGG + Intronic
979821173 4:125173366-125173388 ATTATCACATCAAATTTTGTGGG - Intergenic
979828403 4:125269105-125269127 AATTCCACATGATATTTGGTTGG - Intergenic
979948073 4:126859634-126859656 AATTCCACATGAGATTTGGTGGG + Intergenic
980101212 4:128543156-128543178 ACTGCCACATAAAAAATGGAAGG - Intergenic
980273841 4:130622486-130622508 AATTCCACATGAAATTTAGTTGG - Intergenic
980521416 4:133940631-133940653 GATACCACAGAAAATTTTGTGGG - Intergenic
981884280 4:149654261-149654283 ATTTCAACATAAGATTTGGTGGG - Intergenic
981898787 4:149836548-149836570 ACTACCACATAAAATCAGTGTGG - Intergenic
983494695 4:168429654-168429676 AATTCGACATAAGATTTGGTGGG - Intronic
986102070 5:4621809-4621831 ACTACAACAAAAAAATTGTTTGG - Intergenic
986967088 5:13287155-13287177 CCTACCACTTAAAATTACGTGGG - Intergenic
987822905 5:22989150-22989172 GCTATCAAATAATATTTGGTTGG - Intergenic
987944241 5:24584219-24584241 ACTATCACATACAATTTTGGGGG - Intronic
988084968 5:26463430-26463452 AATTCCACATGAAATTTGGGTGG - Intergenic
988793440 5:34630579-34630601 ACTTCAACATAAATTTTGGAGGG - Intergenic
991063524 5:62402849-62402871 AGTACCACATATAAATTGCTTGG - Intronic
992285623 5:75232548-75232570 AAAAACACACAAAATTTGGTTGG - Intronic
992467601 5:77022564-77022586 ACTACAAGATAAGATTTGGGTGG - Intergenic
993820142 5:92604134-92604156 AATTCCACATAAGATTTGGGTGG + Intergenic
995247504 5:109951096-109951118 ACCACCTTATAAAATTTGGATGG - Intergenic
995740531 5:115351142-115351164 ATTTCTACATGAAATTTGGTTGG + Intergenic
996638698 5:125727746-125727768 AAAACCACAAAAAATTTGCTGGG - Intergenic
996647278 5:125831461-125831483 AATTCCACATGAGATTTGGTGGG - Intergenic
997046798 5:130329054-130329076 AATTCAACATAAAATTTGGGTGG - Intergenic
998487516 5:142516138-142516160 AGTTCCACATAAAATTTGGGTGG - Intergenic
999822585 5:155242763-155242785 ACTACAACAAAAAAATTGATGGG - Intergenic
1000566062 5:162848913-162848935 CCGACCACATAAAATGAGGTAGG - Intergenic
1001655169 5:173343700-173343722 AATTCAACATGAAATTTGGTGGG + Intergenic
1001790122 5:174449175-174449197 ACAAATACATAAAAATTGGTTGG + Intergenic
1003438794 6:6121008-6121030 ATTTCAACATAAAATTTGGAGGG - Intergenic
1004416084 6:15425447-15425469 TCTAACACATGAAATTTGGGGGG - Intronic
1005225053 6:23633093-23633115 ACTACCACTTTAAGTTTGATGGG - Intergenic
1005363622 6:25055860-25055882 ACTACCAGATACAATGTGATTGG + Intergenic
1007873704 6:45070370-45070392 AATACCAAATAAGATTAGGTTGG - Intronic
1008391208 6:50954105-50954127 AGTACTGCACAAAATTTGGTTGG + Intergenic
1010440981 6:75893685-75893707 ACAATCACATACTATTTGGTGGG - Intronic
1010561404 6:77355925-77355947 ACTACAACTGAAAATTTAGTGGG + Intergenic
1010749463 6:79601703-79601725 TCTACCACTTAAAGTTTGTTTGG + Intergenic
1011014329 6:82737980-82738002 TCCACTAAATAAAATTTGGTAGG - Intergenic
1011414249 6:87101158-87101180 ATTTCAACATAAGATTTGGTAGG - Intergenic
1011860081 6:91743667-91743689 ACTAAAACAAAACATTTGGTAGG + Intergenic
1012212132 6:96532423-96532445 ACTGCAACATAAGTTTTGGTGGG - Intronic
1012635766 6:101538898-101538920 ACTACCACATAAAATTTGGTTGG - Intronic
1014024166 6:116625669-116625691 TCTAGCACATAAAAATTTGTTGG - Intronic
1015821619 6:137267095-137267117 ATTTCAACATAATATTTGGTGGG + Intergenic
1016564395 6:145437059-145437081 AATTCCACATGAAATTTGGGTGG - Intergenic
1018744674 6:166752738-166752760 ACAACCACATAAAATGGTGTGGG - Intronic
1021163480 7:17304829-17304851 ACTACCACTTAAAATTTTTTTGG + Intronic
1023431807 7:40101096-40101118 TGTACCACATAAAATTTGTCAGG + Intergenic
1024683905 7:51724183-51724205 ACTATCACATAAAATGAGCTTGG - Intergenic
1024774303 7:52764585-52764607 ATTAACACATAAATTTTGGGTGG - Intergenic
1024861486 7:53847754-53847776 AGGACCACTTAAATTTTGGTAGG + Intergenic
1027298244 7:76801059-76801081 AATAAAACATAAAATTTTGTTGG - Intergenic
1027351654 7:77317781-77317803 GTTAACACAAAAAATTTGGTAGG - Intronic
1027566919 7:79806828-79806850 AATCCGACATGAAATTTGGTTGG - Intergenic
1027708016 7:81558750-81558772 ACTTCCACCTAAAGTTTGGTTGG + Intergenic
1029339565 7:99932011-99932033 ATTACAACATGAGATTTGGTGGG + Intergenic
1030378478 7:108782367-108782389 TCTAACACATAAATTTTGGGGGG + Intergenic
1030416981 7:109257904-109257926 ACTACCAAATGAGATTTGGGTGG - Intergenic
1030459818 7:109819869-109819891 ACTACCCCATAAAATCTGACTGG - Intergenic
1031154912 7:118098219-118098241 ACTACCAGATATAAATTGGTTGG + Intergenic
1031398859 7:121307167-121307189 ACTACCAGATCAAATATGATTGG + Intergenic
1031466577 7:122119578-122119600 ACGACAAAAGAAAATTTGGTAGG - Intronic
1034065906 7:148136237-148136259 ACTTCAACATGAAATTTGGAGGG - Intronic
1034729019 7:153367158-153367180 AATTCAACATAAGATTTGGTGGG + Intergenic
1035405535 7:158594741-158594763 AATTCCACATAAGATTTGGGTGG - Intergenic
1036936507 8:13007368-13007390 ACTAAGACTTAAAATGTGGTTGG + Intronic
1037651937 8:20846850-20846872 TCCACCACATAAATTTTGGGAGG + Intergenic
1038275119 8:26115015-26115037 AATTCCACATAAGATTTGGGTGG - Intergenic
1039402960 8:37287259-37287281 AATTCAACATGAAATTTGGTGGG - Intergenic
1040102112 8:43514836-43514858 AATTCAACATGAAATTTGGTGGG - Intergenic
1040103022 8:43521841-43521863 AATTCCACATAAGGTTTGGTAGG - Intergenic
1041349455 8:56934051-56934073 ACTACAAGATAAGATTTGGGTGG + Intergenic
1042569445 8:70146854-70146876 TCTACTACAAAAAATTTGCTGGG - Intronic
1042685680 8:71437677-71437699 ACTTGCAAATAAAATTTGTTGGG - Intronic
1042954589 8:74235981-74236003 ACAACCAAATAAAATCTTGTCGG - Exonic
1043017671 8:74960832-74960854 ACCACCACACAAAATATGGACGG - Intergenic
1043232164 8:77816851-77816873 ACTAGAACATAAAATTGGATTGG + Intergenic
1043247119 8:78018108-78018130 TCTACTACAATAAATTTGGTTGG + Intergenic
1043360965 8:79471434-79471456 ATTTCAACATACAATTTGGTGGG + Intergenic
1043652515 8:82614257-82614279 ACTGTCACATAAGATTTGGAGGG - Intergenic
1044475112 8:92616817-92616839 GCTACAACATGAAATTTGGGGGG + Intergenic
1045841116 8:106582652-106582674 ACTACTTTATAAAATGTGGTGGG - Intronic
1045907852 8:107369973-107369995 ACAAAAACATAAAATTTGCTGGG + Intronic
1046262013 8:111781003-111781025 ATTTCAACATAAAATTTGGAGGG - Intergenic
1046351811 8:113025232-113025254 ACTACCACATAAAATCGGAAAGG - Intronic
1051520421 9:17981108-17981130 AGTTCAACATAAGATTTGGTGGG + Intergenic
1052089601 9:24312234-24312256 AATTCAACATAAAATTTGGATGG + Intergenic
1052309370 9:27048895-27048917 ATTTCAACATAAAATTTGGAGGG - Intronic
1054149941 9:61593909-61593931 ACTACCATACAAAAATTAGTTGG - Intergenic
1054469708 9:65525012-65525034 ACTACCATACAAAAATTAGTTGG - Intergenic
1058169460 9:101662768-101662790 ACCACCACATAAAAGATAGTTGG - Intronic
1058812480 9:108654520-108654542 ATTACCACTGAAAATTTGTTTGG + Intergenic
1059968609 9:119641312-119641334 ACTTCAACATGAAGTTTGGTGGG - Intergenic
1061729998 9:132606295-132606317 AATGCCACATAAAAATTGGCAGG + Intronic
1186132629 X:6484611-6484633 CCTACCACATAAATTCTGTTAGG - Intergenic
1186145104 X:6617050-6617072 ATTTCCATATAAAATTTGGGTGG - Intergenic
1187034156 X:15519978-15520000 ACATCAACATAAAATTTGGAGGG + Intronic
1188358835 X:29227064-29227086 ATTACCACATTAAATTTAATAGG - Intronic
1188513385 X:30960084-30960106 AATACAACATGAAATTTGGGTGG + Intronic
1188703997 X:33303540-33303562 ACTACAAGATGAAATTTGGGTGG - Intronic
1190539659 X:51464023-51464045 ACTTCAACATGAGATTTGGTGGG + Intergenic
1191041604 X:56087254-56087276 AATTCAACATAAAATTTGGTGGG - Intergenic
1191603377 X:63034657-63034679 ACTACCAAAAAAAATTAGCTGGG + Intergenic
1192685083 X:73295620-73295642 ACTACCATTTAAGATATGGTTGG - Intergenic
1193969786 X:88037448-88037470 ACTACCACCAATAATTTGGAGGG - Intergenic
1194026274 X:88755318-88755340 ACTAACACATAAAATTATGCTGG - Intergenic
1194557127 X:95373468-95373490 ACTACAAGATGAGATTTGGTTGG + Intergenic
1194961701 X:100243564-100243586 ACTTCAACATGAAATTTGGGTGG + Intergenic
1195509981 X:105704158-105704180 ACTTGCACATACAATTTGTTTGG - Intronic
1196246981 X:113411841-113411863 ATTTCAACATGAAATTTGGTGGG + Intergenic
1197840943 X:130745967-130745989 ACTGCCAGAAAATATTTGGTTGG + Intronic
1198175606 X:134151419-134151441 ATTTCAACATAAGATTTGGTGGG + Intergenic
1198805762 X:140492875-140492897 AAAACCACATTAAATTTGATGGG + Intergenic
1199033078 X:143023754-143023776 CATACCACATAAAATAGGGTAGG - Intergenic
1199115408 X:143986129-143986151 ATTTTCACATAAAATTGGGTAGG - Intergenic
1199320516 X:146432611-146432633 ACAACCACATAAAAAAAGGTGGG + Intergenic
1200352026 X:155507461-155507483 AATACCAAATAAAATATGATAGG + Intronic
1200811672 Y:7492229-7492251 ATTATATCATAAAATTTGGTTGG + Intergenic
1201615520 Y:15893264-15893286 CCTACCACATATATTGTGGTAGG + Intergenic
1201792967 Y:17862525-17862547 ACTACTACATAACATTTGCAAGG + Intergenic
1201808587 Y:18043461-18043483 ACTACTACATAACATTTGCAAGG - Intergenic
1202354498 Y:24031769-24031791 ACTACTACATAACATTTGCAAGG + Intergenic
1202516281 Y:25638343-25638365 ACTACTACATAACATTTGCAAGG - Intergenic