ID: 1012636785

View in Genome Browser
Species Human (GRCh38)
Location 6:101552689-101552711
Sequence CAGGTTAGACACATCTGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012636785_1012636788 0 Left 1012636785 6:101552689-101552711 CCCAGACAGATGTGTCTAACCTG 0: 1
1: 0
2: 0
3: 4
4: 90
Right 1012636788 6:101552712-101552734 CTATCTGTGCACCTGAGAATTGG 0: 1
1: 0
2: 1
3: 6
4: 161
1012636785_1012636789 5 Left 1012636785 6:101552689-101552711 CCCAGACAGATGTGTCTAACCTG 0: 1
1: 0
2: 0
3: 4
4: 90
Right 1012636789 6:101552717-101552739 TGTGCACCTGAGAATTGGCAAGG 0: 1
1: 0
2: 1
3: 11
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012636785 Original CRISPR CAGGTTAGACACATCTGTCT GGG (reversed) Intronic
901829752 1:11885198-11885220 CTGCTAAGACACATTTGTCTGGG - Intergenic
904230304 1:29064854-29064876 CAGATTAGTAACATCTGTCCTGG + Intronic
905975339 1:42170099-42170121 AAGGTTACACAGATCTGTATTGG - Intergenic
906708699 1:47913502-47913524 AAGGTCAGACACCTTTGTCTGGG - Intronic
912185831 1:107274868-107274890 CAGCTTAGACACTTTTGTCTGGG + Intronic
913254497 1:116941643-116941665 CAGGTTTGCCACATTTGTCCTGG + Intronic
915161061 1:153921427-153921449 CAGGTTTAACAGATCTGTGTTGG - Intronic
918833762 1:189432790-189432812 AAGGTTAAACACATCAGGCTTGG - Intergenic
919522255 1:198602540-198602562 CAGATAAGAAACATCTTTCTAGG + Intergenic
922063068 1:222110021-222110043 CTGGTTAGATACATCTGCCCTGG + Intergenic
923487160 1:234444618-234444640 CAGGGTATAAGCATCTGTCTGGG - Intronic
1065094487 10:22267185-22267207 CAGGCTTGACAAAGCTGTCTAGG + Intergenic
1068000698 10:51331041-51331063 CATGCTAGCCACATCTGTCCTGG - Intronic
1068087205 10:52389265-52389287 CAGGCTCAACACAGCTGTCTGGG - Intergenic
1069087520 10:64158646-64158668 CATGTTACACACATCTATCCAGG - Intergenic
1070181614 10:74019448-74019470 CAGCTTAAACACCTCTGTTTCGG - Intronic
1070215147 10:74371159-74371181 CATGTTAGAAAAATCAGTCTAGG + Intronic
1070272325 10:74968287-74968309 CAGGTTAAATGCATCTGCCTGGG + Intronic
1071841911 10:89480255-89480277 GAGGTCAGACATATCTGGCTTGG + Intronic
1074187823 10:111112429-111112451 TAGGTCAGACACACCTGTCGTGG - Intergenic
1076806720 10:132862555-132862577 CAGGCTGGAAACATCTGCCTTGG - Intronic
1079885915 11:25988433-25988455 TAGGATAGAAACATCTGTCTGGG - Intergenic
1080805042 11:35645206-35645228 GAGGATAGAGACATCTGTTTTGG - Intergenic
1080929453 11:36793369-36793391 CATGTTTGAAACATGTGTCTGGG + Intergenic
1082893521 11:58165236-58165258 CAGGTTAGACACATACATCATGG + Intronic
1085384835 11:76151648-76151670 CAGATGAGATGCATCTGTCTGGG + Intergenic
1088545184 11:110952016-110952038 CTGTTTAGAAACATCTGTATGGG - Intergenic
1089357236 11:117861932-117861954 CAGGGAGGACACATCTGGCTGGG + Intronic
1091041722 11:132287133-132287155 CTGGTTAGACAGATCTGACAAGG - Intronic
1100657420 12:96661621-96661643 CATGTTAGACTCATCTGCTTAGG + Intronic
1104900986 12:132189473-132189495 CAGTGTAGACACAGCTGCCTAGG + Intergenic
1108672817 13:52709059-52709081 CAGGTGAGACATATCTGACCAGG + Intronic
1126375704 15:47994820-47994842 CACTTTAGATGCATCTGTCTGGG + Intergenic
1131842103 15:96448317-96448339 CAGGTTCAACAAAGCTGTCTGGG + Intergenic
1132394346 15:101460899-101460921 CAGGTTACACACATCTTTCCCGG - Intronic
1138562462 16:57810088-57810110 CAGATGAGACTCATCCGTCTAGG - Intronic
1150601815 17:66657572-66657594 CAGGAGAGACACATTTCTCTGGG + Intronic
1152817936 17:82419247-82419269 CAGGTTGGAGAAAACTGTCTAGG - Intronic
1154352249 18:13594075-13594097 CATTTTATACACATGTGTCTTGG + Intronic
1158496387 18:57958817-57958839 CAGGTTAAGAACCTCTGTCTGGG - Intergenic
1166514860 19:43438742-43438764 CAGATTAGAGACAGCTGTCTTGG - Intergenic
925746578 2:7048868-7048890 CAGCTAAAACACAGCTGTCTTGG + Intronic
925956124 2:8966844-8966866 CATGTTAGACACATGGGTATTGG - Intronic
926755976 2:16236326-16236348 CAGGTAAGAAACAGCTGTCATGG - Intergenic
930287489 2:49449219-49449241 CAGGTTAGAGATGGCTGTCTTGG + Intergenic
933458269 2:82544552-82544574 ATGGGTAGAAACATCTGTCTTGG - Intergenic
934485539 2:94706139-94706161 CAGGTTAGTTACATATGTATAGG + Intergenic
937131620 2:119518255-119518277 CAATTTAGACACATCTGTAAGGG + Intronic
938242969 2:129757390-129757412 CAGGTTGGAGACAGATGTCTGGG - Intergenic
1172110227 20:32540226-32540248 CGGCCTACACACATCTGTCTGGG - Intronic
1178083447 21:29089747-29089769 CAGCTTAGACACATCTTGTTTGG - Intronic
1179292761 21:40033061-40033083 CTGGTTACATACATCTGTATTGG - Intronic
1183308966 22:37098989-37099011 AAGGGGAGGCACATCTGTCTTGG - Intronic
1184503565 22:44888195-44888217 TAGGTCAGACACAGCTGCCTGGG - Intronic
949870934 3:8587959-8587981 CATGTTATACACACATGTCTAGG + Intergenic
951124451 3:18967495-18967517 CATCTTCGACCCATCTGTCTGGG - Intergenic
952978335 3:38715126-38715148 CAGGTGAGACCCAGCTGCCTGGG + Intronic
953064035 3:39452875-39452897 CAGATTAGACACAGCTGAATAGG - Intergenic
953177860 3:40568095-40568117 CAGTTTAAAAACATCTTTCTAGG + Intronic
956527118 3:70177456-70177478 CAGGTTAAGTACATATGTCTGGG + Intergenic
958623011 3:96586029-96586051 CAGTTTAGACCCATCAATCTTGG - Intergenic
961450115 3:126998873-126998895 CAGGCCAGACACACCTGTCGGGG - Intronic
962124413 3:132600618-132600640 CAGGATGTACACATCTGTTTTGG - Exonic
963065260 3:141258609-141258631 CAGGTTCAACAAAGCTGTCTGGG + Intronic
966092044 3:176151274-176151296 CAGGTTAACCACCTCTGACTGGG + Intergenic
967986026 3:195095853-195095875 CACGTTAACCACATCTGGCTGGG + Intronic
969259107 4:6022493-6022515 CAGGTCAGGCACATCTGCCACGG - Intergenic
969577044 4:8042290-8042312 AAGGTTAGACTCATGTTTCTAGG - Intronic
974696717 4:65384958-65384980 CAGCTGAAACACGTCTGTCTCGG + Intronic
976720399 4:88163776-88163798 CAGGTTCAACAAAGCTGTCTGGG + Intronic
977200480 4:94109002-94109024 CAGTTTTGACACATCTTTTTTGG - Intergenic
980639579 4:135559019-135559041 CAGGTTTAGCACATCTATCTTGG + Intergenic
987174302 5:15291726-15291748 CAGCCCAGACACAGCTGTCTGGG - Intergenic
992191578 5:74297048-74297070 CAGATTAGACACAACTCTTTGGG + Intergenic
997473869 5:134131664-134131686 CTGGTTAGTCATCTCTGTCTGGG - Intronic
999697637 5:154200424-154200446 CAGGTTGGAAACATCTGGCAGGG + Intronic
1003096861 6:3149184-3149206 CTGGTTAGACAAAACTGTCCTGG + Intronic
1012636785 6:101552689-101552711 CAGGTTAGACACATCTGTCTGGG - Intronic
1014139543 6:117925678-117925700 CAGTCTGGACACATCTGTCAAGG + Intronic
1015979321 6:138822967-138822989 CAGGATGTACACATCTGTTTTGG - Intronic
1016033444 6:139361374-139361396 GAGGGAAGACACATCTGTCCCGG - Intergenic
1016087348 6:139930072-139930094 CCGGTTAAACACATCAGTCAAGG + Intergenic
1018389509 6:163331545-163331567 CAGGTTAGGCACTTCTCCCTGGG - Intergenic
1030118877 7:106086935-106086957 CAGGTTATTCACAATTGTCTTGG - Intergenic
1032535646 7:132661272-132661294 CAGGATACAGACATCTGACTCGG - Intronic
1034366709 7:150556119-150556141 TAATTTAGACACATTTGTCTTGG - Intergenic
1041106740 8:54452405-54452427 CATCTCAGACACATCTGTGTAGG - Intergenic
1041253231 8:55954999-55955021 TAGGTCACACACATCTGACTGGG + Intronic
1044798257 8:95926221-95926243 AAGATTAAACACATCTGTTTTGG - Intergenic
1045394443 8:101747078-101747100 CAGTTTAGACACCTCTGCTTTGG + Intronic
1050348103 9:4713710-4713732 CAAGCTAGACAAATCTGCCTGGG - Intronic
1055415265 9:76075506-76075528 CAGGTTAAATAAATCTTTCTTGG + Intronic
1186298744 X:8176520-8176542 CAGTGAAGACACATGTGTCTTGG - Intergenic
1192135932 X:68600296-68600318 CAGGTTCAACAAAGCTGTCTGGG + Intergenic
1200142491 X:153909029-153909051 CAGGTGAGGGACATCTGTCCTGG - Intronic